Proefschrift Groeneweg by Nicole Nijhuis

Molecular targets in serous gynecologic cancers

UITNODIGING Voor het bijwonen van de openbare verdediging van het proefschrift

Molecular targets in serous gynecologic cancers door Jolijn Groeneweg Woensdag 4 februari 2015 om 14.30 uur in de Senaatszaal van het Academiegebouw van de Universiteit Utrecht, Domplein 29 te Utrecht. Na afloop bent u van harte welkom op de receptie. Paranimfen Kristine Janssen kristine.janssen@gmail.com +31 6 18 29 34 37 Yvonne White y.white@live.com +1 617 599 6842 English only

Jolijn Groeneweg

Molecular targets in serous gynecologic cancers Jolijn Groeneweg

Jolijn Groeneweg Zwaansteeg 16 3511 VG Utrecht groeneweg.jolijn@gmail.com +31 6 14 46 77 63

Molecular targets in serous gynecologic cancers

2015 University Medical Center Utrecht, Utrecht University, the Netherlands Massachusetts General Hospital, Harvard Medical School, Boston, USA ISBN: 978-94-6108-901-4 Cover design: Marleen Groeneweg Layout and printing: Gildeprint, Enschede, the Netherlands ÂŠÂ J.W. Groeneweg, Utrecht, the Netherlands, 2015. All rights reserved. No part of this thesis may be reproduced, stored in a retrieval system of any nature, or transmitted in any form or by any means without permission of the referenced journals or the author. The author gratefully acknowledges financial support by the VSBfonds. Financial support for printing this thesis was kindly provided by: ChipSoft B.V., Division Woman and Baby of the University Medical Center Utrecht, Goodlife Pharma, Olympus Nederland B.V.

Molecular targets in serous gynecologic cancers Moleculaire targets in sereuze gynaecologische maligniteiten (met een samenvatting in het Nederlands)

Proefschrift ter verkrijging van de graad van doctor aan de Universiteit Utrecht op gezag van de rector magnificus, prof.dr. G.J. van der Zwaan, ingevolge het besluit van het college voor promoties in het openbaar te verdedigen op woensdag 4 februari 2015 des middags te 2.30 uur door

Johanna Willemijntje Groeneweg geboren op 15 november 1984 te Amsterdam

Promotor:

Prof. dr. R.H.M. Verheijen

Copromotoren:

Dr. B.R. Rueda Dr. R.P. Zweemer

Contents Chapter 1

General introduction

Part I: The Notch pathway as therapeutic target in serous gynecologic cancers Chapter 2

Notch signaling in serous ovarian cancer

Chapter 3

Inhibition of Notch signaling in combination with paclitaxel reduces platinum resistant ovarian tumor growth

Chapter 4

The effects of Notch inhibition and platinum-based chemotherapy on ovarian cancer stem cell markers

Chapter 5

Inhibition of gamma-secretase activity impedes uterine serous carcinoma growth in a human xenograft model

Part II: The HER2 receptor as therapeutic target in uterine serous carcinoma Chapter 6

Dual HER2 targeting impedes growth of HER2 gene amplified uterine serous carcinoma xenografts

113

Chapter 7

HER2 over-expressing high grade endometrial cancer expresses high levels of p95HER2 variant

143

Chapter 8

General discussion

161

Chapter 9

Summary Nederlandse samenvatting

177 181

Chapter 10

List of publications Acknowledgements (dankwoord) Curriculum Vitae

187 189 193

Chapter General introduction

Chapter 1

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39 8

General introduction

This thesis describes the role of two distinct molecular alterations in serous carcinomas of the ovary and uterine corpus, and evaluates their potential as therapeutic targets in these cancers. Deregulation of Notch signaling and inhibition of this pathway were studied in serous ovarian and uterine tumors. HER2 expression and anti-HER2 therapies were investigated in serous uterine carcinomas.

Serous gynecologic cancers Serous carcinomas of the ovary Ovarian cancer is the leading cause of death from gynecologic malignancies in the Western world. In the United States alone, approximately 22,000 new diagnoses of ovarian cancer and more than 14,000 deaths attributed to this disease are estimated to occur in 2014.[1] Due to a largely asymptomatic disease progression, approximately 75% of patients present with advanced stage disease at the time of diagnosis.[2] Standard treatment includes cytoreductive surgery in combination with six cycles of platinum and taxane based chemotherapy.[3, 4] Although this treatment strategy leads to complete remission in the majority of patients, most women will develop recurrent disease that is frequently resistant to chemotherapy. [5] Therapeutic options for tumor relapse and chemoresistant disease are limited and the prognosis of ovarian cancer therefore remains unfavorable, with reported 5-year survival rates around 30%.[5, 6] Epithelial ovarian tumors have been divided into type I and type II carcinomas. Type I cancers comprise indolent, low grade tumors often arising from a precursor lesion, while the more prevalent type II carcinomas consist of highly aggressive, genetically instable tumors.[7, 8] High grade serous ovarian cancer represents the vast majority of type II ovarian carcinomas and is the primary focus of the research described in this thesis. The development of novel therapies for recurrent, chemoresistant disease is essential to improve ovarian cancer outcomes. In recent years, numerous investigations have provided a better understanding of the molecular background of high grade serous ovarian cancer, resulting in the identification of potential therapeutic targets.[4, 9, 10] A large genomic analysis of high grade serous ovarian cancers has recently confirmed previous data by describing p53 mutations in nearly all tumors and BRCA1/2 mutations in one fifth of the samples.[11] While mutations in common oncogenes such as PIK3CA and KRAS were rarely

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 1

found, many copy number variations were discovered and pathway analyses did in fact show alteration of PI3K or RAS signaling in 45% of cases as well as altered Notch signaling in 22% of cases.[11] These identified genetic aberrations provide opportunities for novel therapeutic strategies in ovarian cancer. Among the multiple targeted therapies that are being evaluated in ovarian cancer, anti-angiogenesis agents and PARP inhibitors have so far exhibited the most benefit in clinical trials.[12, 13] Ovarian cancer relapse and resistance to chemotherapy have been attributed in part to a subpopulation of tumor cells with stem cell-like properties, referred to as cancer stem cells (CSCs) or tumor-initiating cells.[14, 15] CSCs have been isolated and characterized in numerous solid and hematologic malignancies, based on expression of specific cell surface markers, differential enzymatic activity or formation of a side population capable of efflux of Hoechst dye. Several studies have identified CSCs in ovarian cancer by detecting a side population, fractions expressing CD133, CD44, CD117 or CD24, or cells with ALDH1 enzymatic activity. [16] Isolated ovarian CSCs were shown to possess characteristics such as tumor initiation and chemoresistance. In addition, elevated transcript levels of stem cell related genes have been described in ovarian CSCs.[17, 18] These data suggest that therapeutic strategies targeting the CSC population in ovarian carcinomas may be required to improve the management of recurrent, chemoresistant ovarian cancer. Serous carcinomas of the uterine corpus Uterine serous carcinoma (USC) represents a relatively rare but aggressive subtype of endometrial cancer. Although USC comprises only 10% of endometrial tumors, it accounts for a disproportionate 40% of disease-related deaths.[19] Similar to serous ovarian cancer it is often diagnosed at an advanced stage, when metastatic disease is already present. The primary therapeutic management includes staging or cytoreductive surgery followed by platinum-based chemotherapy and adjuvant radiation therapy.[20] Due to high rates of recurrence and chemoresistance, the prognosis of USC is poor with estimated 5-year survival rates of approximately 30%.[21] These numbers illustrate the need for the development of novel treatment modalities for USC. Recent investigations have shed light on the molecular profile of USC. While mutations of p53 and PIK3CA and amplification of the ERBB2 (HER2) gene were frequently seen in USC, PTEN mutations were found to be relatively uncommon.[22, 23] Although the described genetic landscape of serous uterine tumors is evidently different from the alterations

General introduction

observed in the far more common endometrial tumors of endometrioid histology, similar molecular aberrations between USC and serous ovarian cancer have been established.[22] These findings suggest that therapeutic targeting of shared molecular features in serous ovarian and uterine tumors may provide novel treatment strategies in both forms of serous gynecologic cancers.

Notch and HER2: potential therapeutic targets Notch signaling The Notch pathway plays an important role in embryonic development and in self-renewal of adult stem cells. Notch signaling is implicated in the regulation of cell proliferation, differentiation, apoptosis and cell fate.[24] More recently, deregulation of the Notch cascade has been described in a variety of solid and hematologic malignancies.[25, 26] The pathway is activated when one of four Notch receptors (Notch1-4) binds with one of its ligands (Jagged and Delta-like) on a neighboring cell. This activation leads to proteolytic cleavage of the Notch receptor by a disintegrin and metalloprotease (ADAM) and gamma-secretase, resulting in the release of the Notch intracellular domain (NICD). This NICD then translocates to the nucleus, where it activates transcription of target genes including Hes and Hey family members.[27, 28] Many studies have suggested an oncogenic role of Notch signaling in malignant transformation, although tumor-suppressive functions have also been described.[29] In ovarian cancer, high expression levels of Notch1 and Notch3 have been observed.[30-32] This increased expression correlated with chemoresistance and a worse prognosis.[33-35] In addition, elevated transcript levels of Notch pathway genes were found in ovarian CSCs, compared with the non-CSC populations.[17, 18] Preclinical studies have assessed the effectiveness of therapeutic targeting of the Notch pathway in multiple cancers, with gamma-secretase inhibitors (GSIs) being the most widely used Notch inhibitors.[36, 37] In ovarian cancer, GSI treatment led to growth inhibition of cell lines and cell line derived xenografts as well as increased sensitivity to platinum-based chemotherapy in these cell lines.[38] In USC, Notch expression and the efficacy of targeting this pathway have yet to be determined.

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 1

The HER2 receptor Human epidermal growth factor receptor 2 (HER2), otherwise called HER2/neu or erbB2, represents one of four members of the human epidermal growth factor receptor (EGFR) family.[39] Dimerization of this tyrosine kinase receptor, either with a twin receptor (homodimerization) or another EGFR family member (heterodimerization), leads to activation of downstream signaling of the mitogen-activated protein kinase (MAPK) and phosphatidylinositol 3-kinase (PI3K) pathways.[40] These signaling events induce cell proliferation and survival and can promote oncogenic transformation. While the other EGFR family members are activated by ligand binding, HER2 has no known ligand and may be constitutively activated upon over-expression of the receptor.[39] Amplification of the HER2 gene and over-expression of the HER2 protein have been described in many malignancies, with high rates of HER2 gene amplification observed in breast and gastric cancers.[41, 42] Therapies targeting the HER2 receptor, such as the monoclonal antibody trastuzumab or the tyrosine kinase inhibitor lapatinib, have become an important therapeutic strategy in breast and gastric tumors harboring HER2 protein over-expression or gene amplification.[42, 43] Similar to breast cancer, a 13-42% rate of HER2 gene amplification has been described in USC, with up to 70% of tumors showing HER2 protein over-expression.[44-47] HER2 overexpression was found to be associated with decreased overall survival in USC patients.[44] While previous preclinical studies have shown in vitro effectiveness of anti-HER2 therapies in HER2 amplified USC cell lines [48, 49], a recent phase II clinical trial found no response to trastuzumab treatment in patients with HER2 positive recurrent endometrial tumors.[50]

Aims and outline of this thesis The first part of the thesis focuses on the Notch pathway as a potential therapeutic target in serous gynecologic cancers. Chapter 2 reviews the current literature regarding the role of Notch signaling in serous ovarian cancer and the therapeutic effectiveness of Notch pathway inhibition in this disease. The aim of the research described in chapter 3 was to study the efficacy of Notch inhibition as monotherapy and in combination with standard chemotherapy in patient derived ovarian cancer xenografts. We then aimed to assess the effects of these therapies on the presence of CSCs (chapter 4), by evaluating the expression of CSC markers and stem cell related genes following treatment with GSI or paclitaxel and carboplatin in patient derived xenografts. The objective of the study presented in chapter 5 was to study Notch1 expression and the efficacy of targeting Notch with a GSI in serous carcinomas of the uterus, using cell lines as well as cell line derived and patient derived xenografts.

General introduction

The second part of the thesis describes the role of HER2 and the efficacy of HER2 inhibition in serous uterine cancers. The aim of the investigation shown in chapter 6 was to evaluate the effectiveness of anti-HER2 therapies in USC, both in vitro using USC cell lines and in vivo using xenografts derived from cell lines and primary human USC tissue samples. In chapter 7, we present our research on p95HER2 expression in high grade endometrial carcinomas including USC. Finally, chapter 8 entails the discussion of the main findings of the research included in this thesis.

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 1

References 1.

Siegel R, Ma J, Zou Z, Jemal A. Cancer statistics, 2014. CA Cancer J Clin. 2014 Jan;64(1):9-29.

Hennessy BT, Coleman RL, Markman M. Ovarian cancer. Lancet. 2009 Oct 17;374(9698):1371-82.

Ozols RF, Bundy BN, Greer BE, Fowler JM, Clarke-Pearson D, Burger RA, et al. Phase III trial of carboplatin and paclitaxel compared with cisplatin and paclitaxel in patients with optimally resected stage III ovarian cancer: A gynecologic oncology group study. J Clin Oncol. 2003 Sep 1;21(17):3194-200.

Coleman RL, Monk BJ, Sood AK, Herzog TJ. Latest research and treatment of advanced-stage epithelial ovarian cancer. Nat Rev Clin Oncol. 2013 Apr;10(4):211-24.

Cooke SL, Brenton JD. Evolution of platinum resistance in high-grade serous ovarian cancer. Lancet Oncol. 2011 Nov;12(12):1169-74.

Armstrong DK, Bundy B, Wenzel L, Huang HQ, Baergen R, Lele S, et al. Intraperitoneal cisplatin and paclitaxel in ovarian cancer. N Engl J Med. 2006 Jan 5;354(1):34-43.

Kurman RJ, Shih I. Molecular pathogenesis and extraovarian origin of epithelial ovarian cancer--shifting the paradigm. Hum Pathol. 2011 Jul;42(7):918-31.

Lim D, Oliva E. Precursors and pathogenesis of ovarian carcinoma. Pathology. 2013 Apr;45(3):229-42.

Banerjee S, Kaye SB. New strategies in the treatment of ovarian cancer: Current clinical perspectives and future potential. Clin Cancer Res. 2013 Mar 1;19(5):961-8.

10.

Birrer MJ. Ovarian cancer: Targeting the untargetable. Am Soc Clin Oncol Educ Book. 2014:13-5.

11.

Cancer Genome Atlas Research Network. Integrated genomic analyses of ovarian carcinoma. Nature. 2011 Jun 29;474(7353):609-15.

12.

Perren TJ, Swart AM, Pfisterer J, Ledermann JA, Pujade-Lauraine E, Kristensen G, et al. A phase 3 trial of bevacizumab in ovarian cancer. N Engl J Med. 2011 Dec 29;365(26):2484-96.

13.

Gelmon KA, Tischkowitz M, Mackay H, Swenerton K, Robidoux A, Tonkin K, et al. Olaparib in patients with recurrent high-grade serous or poorly differentiated ovarian carcinoma or triple-negative breast cancer: A phase 2, multicentre, open-label, non-randomised study. Lancet Oncol. 2011 Sep;12(9):852-61.

14.

Dalerba P, Cho RW, Clarke MF. Cancer stem cells: Models and concepts. Annu Rev Med. 2007;58:267-84.

15.

Dean M, Fojo T, Bates S. Tumour stem cells and drug resistance. Nat Rev Cancer. 2005 Apr;5(4):275-84.

16.

Foster R, Buckanovich RJ, Rueda BR. Ovarian cancer stem cells: Working towards the root of stemness. Cancer Lett. 2013 Sep 10;338(1):147-5.

17.

Zhang S, Balch C, Chan MW, Lai HC, Matei D, Schilder JM, et al. Identification and characterization of ovarian cancer-initiating cells from primary human tumors. Cancer Res. 2008 Jun 1;68(11):4311-20.

18.

Vathipadiekal V, Saxena D, Mok SC, Hauschka PV, Ozbun L, Birrer MJ. Identification of a potential ovarian cancer stem cell gene expression profile from advanced stage papillary serous ovarian cancer. PLoS One. 2012;7(1):e29079.

19.

Hamilton CA, Cheung MK, Osann K, Chen L, Teng NN, Longacre TA, et al. Uterine papillary serous and clear cell carcinomas predict for poorer survival compared to grade 3 endometrioid corpus cancers. Br J Cancer. 2006 Mar 13;94(5):642-6.

20.

Boruta DM,2nd, Gehrig PA, Fader AN, Olawaiye AB. Management of women with uterine papillary serous cancer: A society of gynecologic oncology (SGO) review. Gynecol Oncol. 2009 Oct;115(1):142-53.

21.

Acharya S, Hensley ML, Montag AC, Fleming GF. Rare uterine cancers. Lancet Oncol. 2005 Dec;6(12):961-7.

22.

Cancer Genome Atlas Research Network, Kandoth C, Schultz N, Cherniack AD, Akbani R, Liu Y, et al. Integrated genomic characterization of endometrial carcinoma. Nature. 2013 May 2;497(7447):67-73.

23.

Zhao S, Choi M, Overton JD, Bellone S, Roque DM, Cocco E, et al. Landscape of somatic single-nucleotide and copy-number mutations in uterine serous carcinoma. Proc Natl Acad Sci U S A. 2013 Feb 19;110(8):2916-21.

24.

Artavanis-Tsakonas S, Rand MD, Lake RJ. Notch signaling: Cell fate control and signal integration in development. Science. 1999 Apr 30;284(5415):770-6.

General introduction

25.

Miele L, Golde T, Osborne B. Notch signaling in cancer. Curr Mol Med. 2006 Dec;6(8):905-18.

26.

Hu YY, Zheng MH, Zhang R, Liang YM, Han H. Notch signaling pathway and cancer metastasis. Adv Exp Med Biol. 2012;727:186-98.

27.

Bray SJ. Notch signalling: A simple pathway becomes complex. Nat Rev Mol Cell Biol. 2006 Sep;7(9):678-89.

28.

Kopan R, Ilagan MX. The canonical notch signaling pathway: Unfolding the activation mechanism. Cell. 2009 Apr 17;137(2):216-33.

29.

Ranganathan P, Weaver KL, Capobianco AJ. Notch signalling in solid tumours: A little bit of everything but not all the time. Nat Rev Cancer. 2011 May;11(5):338-51.

30.

Rose SL, Kunnimalaiyaan M, Drenzek J, Seiler N. Notch 1 signaling is active in ovarian cancer. Gynecol Oncol. 2010 Apr;117(1):130-3.

31.

Park JT, Li M, Nakayama K, Mao TL, Davidson B, Zhang Z, et al. Notch3 gene amplification in ovarian cancer. Cancer Res. 2006 Jun 15;66(12):6312-8.

32.

Choi JH, Park JT, Davidson B, Morin PJ, Shih I, Wang TL. Jagged-1 and Notch3 juxtacrine loop regulates ovarian tumor growth and adhesion. Cancer Res. 2008 Jul 15;68(14):5716-23.

33.

Wang M, Wang J, Wang L, Wu L, Xin X. Notch1 expression correlates with tumor differentiation status in ovarian carcinoma. Med Oncol. 2010 Dec;27(4):1329-35.

34.

Park JT, Chen X, Trope CG, Davidson B, Shih I, Wang TL. Notch3 overexpression is related to the recurrence of ovarian cancer and confers resistance to carboplatin. Am J Pathol. 2010 Sep;177(3):1087-94.

35.

Rahman MT, Nakayama K, Rahman M, Katagiri H, Katagiri A, Ishibashi T, et al. Notch3 overexpression as potential therapeutic target in advanced stage chemoresistant ovarian cancer. Am J Clin Pathol. 2012 Oct;138(4):535-44.

36.

Rizzo P, Osipo C, Foreman K, Golde T, Osborne B, Miele L. Rational targeting of notch signaling in cancer. Oncogene. 2008 Sep 1;27(38):5124-31.

37.

Takebe N, Nguyen D, Yang SX. Targeting notch signaling pathway in cancer: Clinical development advances and challenges. Pharmacol Ther. 2014 Feb;141(2):140-9.

38.

McAuliffe SM, Morgan SL, Wyant GA, Tran LT, Muto KW, Chen YS, et al. Targeting notch, a key pathway for ovarian cancer stem cells, sensitizes tumors to platinum therapy. Proc Natl Acad Sci U S A. 2012 Oct 23;109(43):E2939-48.

39.

Yarden Y, Sliwkowski MX. Untangling the ErbB signalling network. Nat Rev Mol Cell Biol. 2001 Feb;2(2):127-3.

40.

Citri A, Yarden Y. EGF-ERBB signalling: Towards the systems level. Nat Rev Mol Cell Biol. 2006 Jul;7(7):505-16.

41.

Spector NL, Blackwell KL. Understanding the mechanisms behind trastuzumab therapy for human epidermal growth factor receptor 2-positive breast cancer. J Clin Oncol. 2009 Dec 1;27(34):5838-47.

42.

Hechtman JF, Polydorides AD. HER2/neu gene amplification and protein overexpression in gastric and gastroesophageal junction adenocarcinoma: A review of histopathology, diagnostic testing, and clinical implications. Arch Pathol Lab Med. 2012 Jun;136(6):691-7.

43.

Baselga J. Treatment of HER2-overexpressing breast cancer. Ann Oncol. 2010 Oct;21 Suppl 7:vii36-40.

44.

Slomovitz BM, Broaddus RR, Burke TW, Sneige N, Soliman PT, Wu W, et al. Her-2/neu overexpression and amplification in uterine papillary serous carcinoma. J Clin Oncol. 2004 Aug 1;22(15):3126-32.

45.

Santin AD, Bellone S, Van Stedum S, Bushen W, De Las Casas LE, Korourian S, et al. Determination of HER2/ neu status in uterine serous papillary carcinoma: Comparative analysis of immunohistochemistry and fluorescence in situ hybridization. Gynecol Oncol. 2005 Jul;98(1):24-30.

46.

Buza N, English DP, Santin AD, Hui P. Toward standard HER2 testing of endometrial serous carcinoma: 4-year experience at a large academic center and recommendations for clinical practice. Mod Pathol. 2013 Dec;26(12):1605-12.

47.

Mentrikoski MJ, Stoler MH. HER2 immunohistochemistry significantly overestimates HER2 amplification in uterine papillary serous carcinomas. Am J Surg Pathol. 2014 Jun;38(6):844-51.

48.

Santin AD, Bellone S, Gokden M, Palmieri M, Dunn D, Agha J, et al. Overexpression of HER-2/neu in uterine serous papillary cancer. Clin Cancer Res. 2002 May;8(5):1271-9.

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 1

49.

El-Sahwi K, Bellone S, Cocco E, Cargnelutti M, Casagrande F, Bellone M, et al. In vitro activity of pertuzumab in combination with trastuzumab in uterine serous papillary adenocarcinoma. Br J Cancer. 2010 Jan 5;102(1):134-43.

50.

Fleming GF, Sill MW, Darcy KM, McMeekin DS, Thigpen JT, Adler LM, et al. Phase II trial of trastuzumab in women with advanced or recurrent, HER2-positive endometrial carcinoma: A gynecologic oncology group study. Gynecol Oncol. 2010 Jan;116(1):15-20.

General introduction

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Part I The Notch pathway as therapeutic target in serous gynecologic cancers

Chapter

Notch signaling in serous ovarian cancer

Jolijn W. Groeneweg1,2, Rosemary Foster1,2,3, Whitfield B. Growdon1,2,3, RenĂŠ H.M. Verheijen4, Bo R. Rueda1,2,3

Vincent Center for Reproductive Biology, Department of Obstetrics and Gynecology, Massachusetts General Hospital, Boston, MA, United States

Harvard Medical School, Boston, MA, United States

Division of Gynecologic Oncology, Department of Obstetrics and Gynecology, Massachusetts General Hospital, Boston, MA, United States

Department of Gynecologic Oncology, Division of Woman and Baby, University Medical Center Utrecht, Utrecht, The Netherlands.

Journal of Ovarian Research 2014;7(1):95 [Epub ahead of print]

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 2

Abstract Ovarian cancer is the most lethal of all gynecologic malignancies because women commonly present with advanced stage disease and develop chemotherapy refractory tumors. While cytoreductive surgery followed by platinum based chemotherapy are initially effective, ovarian tumors have a high propensity to recur highlighting the distinct need for novel therapeutics to improve outcomes for affected women. The Notch signaling pathway plays an established role in embryologic development and deregulation of this signaling cascade has been linked to many cancers. Recent genomic profiling of serous ovarian carcinoma revealed that Notch pathway alterations are among the most prevalent detected genomic changes. A growing body of scientific literature has confirmed heightened Notch signaling activity in ovarian carcinoma, and has utilized in vitro and in vivo models to suggest that targeting this pathway with gamma secretase inhibitors (GSIs) leads to anti-tumor effects. While it is currently unknown if Notch pathway inhibition can offer clinical benefit to women with ovarian cancer, several GSIs are currently in phase I and II trials across many disease sites including ovary. This review will provide background on Notch pathway function and will focus on the preclinical literature that links altered Notch signaling to ovarian cancer progression.

Notch signaling in serous ovarian cancer

Introduction Ovarian cancer represents the most lethal gynecologic malignancy in the United States. In 2014 alone, approximately 22,000 women are estimated to be diagnosed with ovarian cancer and more than 14,000 deaths attributed to the disease are projected to occur.[1] This high mortality is explained in part by the advanced disease stage at the time of diagnosis with approximately 75% of the patients presenting with stage III - IV disease.[2] Therapeutic strategies include cytoreductive surgery followed by six cycles of platinum and taxane based chemotherapy.[3, 4] Despite the fact that the majority of patients achieve complete clinical remission following this treatment regimen, the prognosis of ovarian cancer remains unfavorable with a 5-year survival rate of approximately 50%.[4] This poor outcome is mainly attributed to the development of recurrent disease that is often resistant to chemotherapy. [5, 6] Treatment options for recurrent ovarian cancer are currently limited and not curative, warranting the development of novel therapeutic strategies. Epithelial ovarian malignancies comprise heterogeneous tumors, both on a cellular and a molecular level. A recently developed dualistic model divides the different ovarian cancer subtypes into type I and type II carcinomas.[7] Type I tumors comprise low-grade serous, low-grade endometrioid, clear cell and mucinous ovarian cancers. They are characterized by indolent, genetically stable tumors that arise from a precursor lesion, often present at an early stage and are relatively resistant to cytotoxic therapy. In contrast, the more prevalent type II tumors are highly aggressive, present at an advanced stage, typically harbor TP53 mutations that lead to genetic instability, and are initially more sensitive to chemotherapeutic agents. While high-grade serous carcinomas account for the vast majority of type II ovarian cancers, other subtypes include high-grade endometrioid ovarian carcinoma and carcinosarcomas. [8, 9] In recent years, multiple genetic and epigenetic abnormalities as well as changes in molecular pathways have been identified that are often characteristic for specific histologic subtypes.[10, 11] Therapeutic targeting of the molecular aberrations and cellular signaling pathways involved in tumor progression may provide novel treatment options for women with recurrent ovarian cancer. This review will focus on the role of the Notch signaling cascade in high-grade serous ovarian cancer and the potential therapeutic effectiveness of Notch pathway inhibition in this disease.

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 2

The Notch signaling pathway Functions of Notch signaling The evolutionary conserved Notch pathway was first discovered in Drosophila a century ago, when flies with a mutation in the Notch gene were found to have wing deformities.[12] The functional significance of the Notch signaling cascade has been well established in neural development [13, 14] and has since been established in multiple cellular processes, during embryonic development and in self-renewing adult tissues.[15, 16] The Notch pathway functions through cell-to-cell contact and is involved in the regulation of proliferation, differentiation and apoptosis, depending on the cellular context.[17, 18] In adult tissues, Notch signaling acts to control tissue homeostasis and stem cell maintenance. Notch receptors and ligands Thus far, four Notch receptors (Notch1-4) and five ligands have been identified in mammals. Three ligands belong to the Delta-like family (Dll1, 3 and 4) and two ligands (Jagged1 (Jag1) and Jagged2 (Jag2)) are Serrate-like.[19-23] Notch receptors as well as their ligands are singlepass transmembrane proteins with extracellular domains that consist of multiple epidermal growth factor (EGF)-like repeats.[24, 25] The receptors are synthesized as inactive precursors in the endoplasmic reticulum that are proteolytically cleaved by furin-like convertases in the trans-Golgi compartment.[26] This first cleavage, termed S1, results in an extracellular N-terminal fragment and a transmembrane C-terminal fragment that also includes the Notch intracellular domain (NICD). Finally, non-covalent binding between the two fragments forms the mature Notch heterodimeric receptor (Figure 1).[27] During the process of Notch receptor synthesis, the extracellular fragment is glycosylated by Fringe glycosyltransferases, which modifies the binding affinity between the receptor and its ligands.[28, 29] Signaling cascade As shown in Figure 1, Notch signaling is activated by a receptor-ligand binding between two neighboring cells, leading to a conformational change of the Notch receptor and exposure of a cleavage site (S2) in its extracellular domain.[30, 31] S2 cleavage by A Disintegrin And Metalloprotease (ADAM) 10 or 17 produces an intermediate transmembrane fragment termed NEXT (Notch extracellular truncation) which is accessible to gamma-secretase for S3 cleavage.[32] The gamma-secretase complex consists of four subunits: the catalytic subunit presenilin, nicastrin, APH-1 and PEN-2.[33] S3 cleavage by gamma-secretase leads to release of the NICD, which translocates to the nucleus and binds to the DNA bound CBF-1/Su(H)/

Notch signaling in serous ovarian cancer

Lag-1 protein complex (CSL, also known as RBP-jκ) that constitutively represses transcription in the absence of NICD.[34, 35] The NICD displaces a co-repressor complex from CSL and recruits co-activators such as Mastermind-like 1 (MAML1), allowing the transcription of Notch target genes.[34, 36]

2 ADAM10, 17 S2 Cleavage

Dll1, 3, 4 Jag1, 2 Notch Receptor

γ-secretase S3 Cleavage

MAML

Furin

S1 Cleavage

CoA CSL

NICD

Target Genes

PL TO

EU CL

GOLGI

ASM

CoR CSL

ENDOPLASMIC RETICULUM

Figure 1. The Notch signaling pathway.

Notch target genes The most well-known Notch target genes are transcription factors of the Hairy/Enhancer of Split (Hes) and Hes-related (Hey) families.[37] Hes and Hey members are helix-loop-helix proteins, forming homo-or heterodimers that regulate transcription of genes involved in cell fate determination.[37-39] Other Notch pathway targets include cell cycle regulators cyclin D1 and p21, NF-κB family members, c-Myc and Deltex.[40-43]

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 2

Crosstalk with other signaling pathways The Notch pathway is part of a complex network of developmental signaling pathways that also includes the Hedgehog, Wnt, transforming growth factor-Î˛ (TGF-Î˛) and Janus kinase/ signal transducers and activators of transcription (Jak/STAT) pathways.[44, 45] The Notch pathway has also been implicated as interacting with the EGFR/HER2 receptor tyrosine kinase family as well as the phosphatidylinositol 3-kinase/AKT/mTOR signaling cascade, two central growth pathways in the physiologic and neoplastic setting.[46] Although integration of Notch signaling with signals from other pathways has been a focus of investigation, the exact mechanisms of this crosstalk remain largely unknown. The interaction of Notch signaling with other pathways highly depends on the cellular context, and differs from one cellular environment to another. For example, the Notch and Wnt pathways were found to cooperate in maintaining undifferentiated hematopoietic stem cells [47], whereas an antagonistic interaction between Wnt and Notch has been reported in Drosophila development.[48] Similarly, opposed functions in distinct cellular contexts have been reported for the Notch and Ras pathways. Notch signaling was shown to complement the Ras pathway during Drosophila eye development [49], while inhibition of the Ras pathway by Notch signaling has been demonstrated in C. elegans hermaphrodite vulval development.[50, 51] Activation of Sonic Hedgehog (Shh) led to upregulation of Notch signaling and determination of arterial cell fate in zebrafish [52], and induction of Shh has been observed in murine somatic and human embryonic stem cells following Notch receptor activation.[53] The phosphatidylinositol 3-kinase (PI3K)-AKT and Notch signaling cascades were found to interact agonistically during murine hematopoietic stem cell differentiation and in a variety of human cell types including T-cells and neurons.[54, 55] Negative crosstalk between the EGFR and Notch pathways has been described in Drosophila wing development [56, 57], while Notch signaling was shown to activate HER2 (ERBB2) in human embryonic kidney cells.[58]

Notch signaling in cancer Oncogenic Notch signaling was first described in T-cell acute lymphoblastic leukemia (T-ALL), in which a chromosomal translocation event generates a constitutively active variant of Notch1.[59] Later studies have shown that Notch1 activating mutations occur in the majority of T-ALLs.[60] Deregulation of Notch receptors, ligands or targets has since been described in a variety of solid and hematological tumors including breast [61, 62], pancreatic [63], brain [64], lung [65], ovarian [11], head and neck [66] and colorectal [67] cancer, as well as

Notch signaling in serous ovarian cancer

leukemia [60, 68], lymphomas [69, 70] and multiple myeloma.[71] While these and other studies demonstrate Notch pathway involvement in tumor initiation and progression, tumor suppressive roles of Notch signaling have also been reported.[72, 73] Most notably, Notch functions as a tumor suppressor in the skin, and loss-of-function mutations in Notch receptors have been identified in cutaneous squamous cell carcinoma.[74, 75] Although little is known about the mechanisms behind these contradictory actions of the Notch pathway in cancer, it is generally assumed that the various outcomes of Notch signaling depend on interactions with the microenvironment and crosstalk with other signaling pathways.[72] Notch signaling in serous ovarian cancer In ovarian cancer, a role for Notch signaling was first discovered in two studies aimed at identifying potential diagnostic markers of epithelial ovarian cancer. Gene expression of human ovarian cancer samples or cell lines was evaluated and compared to normal ovarian surface epithelium samples or cell lines, respectively.[76, 77] One study reported upregulation of the Notch3 gene in all analyzed ovarian cancers [76], while the second study reported increased Jag2 gene expression in ovarian cancer cell lines compared with benign controls.[77] Subsequently, Park et al. used a single nucleotide polymorphism (SNP) array to analyze DNA copy number alterations in high-grade serous ovarian carcinomas and identified an amplicon corresponding to the Notch3 locus in 20% of cases. Notch3 gene amplification correlated with Notch3 protein overexpression, as determined by fluorescent in situ hybridization and immunohistochemistry (IHC).[78] These results were confirmed by others, who demonstrated amplification of the Notch3 gene using a SNP array in 21% of analyzed ovarian cancers.[79] Moreover, recent large-scale genomic and epigenomic analyses of high-grade serous ovarian carcinomas by The Cancer Genome Atlas (TCGA) Network revealed altered Notch signaling in 22% of cases with alterations in Notch3 occurring in 50% of those cases.[11] In a study of Notch ligands, Jag1 was shown to be the most highly expressed ligand in both ovarian cancer cells and surrounding peritoneal mesothelial cells with interaction of Jag1 and Notch3 resulting in activation of the signaling cascade and promotion of cell proliferation and adhesion.[80] In addition, Pbx1 and DLGAP5 have been identified as direct target genes of Notch3 in ovarian cancer, and knockdown of either target with shRNAs led to reduced cell proliferation and, in the case of Pbx1 knockdown, impaired tumor formation.[81, 82] More recently, the TCGA data generated from 488 ovarian cancer patients were used to analyze epigenetic changes of genes of the Notch superfamily. Inverse correlations were found between DNA methylation and expression of the Notch pathway target genes CCND1 and PPARG and the Notchinteracting gene RUNX1. Additionally, an inverse correlation in expression was established

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 2

between CCND1, PPARG and RUNX1 and specific miRNAs that regulate each of those genes. Subsequent survival analyses revealed significantly poorer overall survival rates of patients with high CCND1, PPARG and RUNX1 gene expression and low methylation or low levels of the relevant miRNAs compared with patients with low gene expression and high methylation or high miRNA levels.[83] Furthermore, several groups have linked Notch3 expression to the clinical prognosis of ovarian cancer. Using quantitative reverse transcription polymerase chain reaction (RT-PCR) and IHC, Jung et al. observed elevated mRNA levels of Notch3, Jag1 and Jag2 as well as higher Notch3 and Jag2 protein expression in serous ovarian cancer samples as compared to benign controls. High Notch3 mRNA expression correlated significantly with worse overall survival and clinical chemoresistance, and Notch3 protein overexpression was significantly associated with the prognostic parameters advanced stage disease, lymph node metastases and distant metastases.[84] Moreover, elevated nuclear Notch3 immunostaining has been found in recurrent serous ovarian carcinoma specimens as compared to primary ovarian cancer samples from the same patients. A significant association between high Notch3 mRNA or nuclear Notch3 protein levels and worse overall and progression-free survival rates was also described.[85, 86] Ectopic expression of Notch3 following transduction with a Notch3 intracellular domain (NICD3) in ovarian surface epithelium and low-grade serous ovarian cancer cell lines with low endogenous Notch3 expression led to increased resistance to carboplatin in vitro. Inversely, shRNA-mediated knockdown of Notch3 in OVCAR3 cells resulted in higher sensitivity to carboplatin, compared with OVCAR3 cells transduced with a non-specific control shRNA.[85] The role of Notch1 in ovarian cancer was first studied by Hopfer et al. [87], who evaluated mRNA expression of Notch pathway members in ovarian adenocarcinomas, borderline tumors and adenomas and demonstrated more frequent expression of Jag2 and DLL1 in adenocarcinomas as compared to adenomas. Although quantitative RT-PCR and Western blot analyses revealed similar Notch1 expression levels in ovarian adenocarcinomas and adenomas, stable transfection of A2780 ovarian cancer cells with the intracellular domain of Notch1 (NICD1) increased cell proliferation and enhanced colony-formation capacity, suggesting a role for Notch1 signaling in ovarian tumor growth.[87] Analyses of the NICD1 protein by other investigators revealed high NICD1 levels in OVCAR3, SKOV3 and CaOV3 cell lines. Additionally, NICD1 was expressed in 76% of primary human serous ovarian cancer samples, as assessed by Western blotting. Subsequent siRNA downregulation of NICD1 in all three ovarian cancer cell lines resulted in inhibition of cell proliferation.[88] Results obtained from PCR, immunoblotting or functional studies of Notch1 have been easily interpreted. In

Notch signaling in serous ovarian cancer

contrast, IHC analyses of Notch1 expression in ovarian cancer have produced variable results. Wang and colleagues used IHC to study Notch1 levels in ovarian cancer specimens of various histological grades as well as patient-matched contralateral benign ovarian samples and normal ovarian tissues. Notch1 immunostaining was observed in 95% of analyzed serous ovarian cancer specimens versus 8% and 6% of matched benign controls and normal ovarian samples, respectively. Notch1 immunostaining was predominantly found in the cell membrane and cytoplasm. Positivity scores correlated with histological grade and clinical disease stage, and the IHC findings were confirmed by Western blotting and quantitative RT-PCR.[89] An IHC protocol was recently developed to detect the gamma-secretase cleaved NICD1. In contrast to the findings of the full-length Notch1 IHC studies, NICD1 was not expressed in any of the 147 analyzed ovarian cancer specimens although a subset of samples from other cancer types showed nuclear NICD1 immunostaining with this method.[90] In another study, IHC analysis of 10 serous ovarian tumors detected expression of Notch1, Jag1 and Dll1 in both cytoplasm and nucleus, and the observed Notch1 protein levels correlated significantly with metastasis in this small cohort.[91] Notch signaling in serous ovarian cancer stem cells A few investigations have shown elevated Notch levels in recurrent or chemoresistant ovarian cancer. In ovarian cancer and many other malignancies, the development of recurrent disease has been attributed, at least in part, to a tumorigenic and chemotherapy resistant sub-population of cancer cells called tumor-initiating or cancer stem cells (CSCs).[92-94] Consistent with this hypothesis, increased expression of CSC markers and enrichment of the side population (cells showing increased efflux of Hoechst dye as identified by flow cytometry, reviewed in Foster et al. [95]) have been observed in ovarian cancer samples following platinum based chemotherapy, compared with chemotherapy naive cells.[96, 97] Similarly, increased resistance to cisplatin and paclitaxel has been demonstrated in sphere forming primary serous ovarian cancer cells, cultured under stem cell-selective conditions, compared with the same cells cultured under differentiating conditions. These spheroid ovarian CSCs also showed elevated levels of the CSC marker proteins CD44 and CD117 as well as an increase in mRNA levels of Notch1 and other stem cell genes, compared with differentiated cells and parental bulk tumor cells.[98] Retrovirus-mediated overexpression of the Notch3 intracellular domain (NICD3) in ovarian surface epithelium and low-grade serous ovarian cancer cell lines with low endogenous Notch3 levels led to upregulation of the stem cell associated genes Nanog and Oct4, further suggesting a role of the Notch pathway in CSC function.[85] Furthermore, gene microarray analyses of serous ovarian cancer side population cells from ascites samples showed upregulation of three genes involved in Notch

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 2

signaling, compared with main population cells. These genes, ADAM19, FPTG and ST3GAL6, were also found to be overexpressed in recurrent ovarian cancer specimens, compared with matched primary samples.[99] Supporting these findings, Steg and colleagues have reported increased transcript levels of stem cell pathway genes, including the Notch pathway member presenilin 2 (PSEN2), in recurrent ovarian cancer samples compared with matched primary tumors.[96] Collectively, these studies provide evidence suggesting that Notch signaling is enhanced in ovarian CSCs, as compared to tumor bulk cells. Notch signaling and epithelial-to-mesenchymal transition in serous ovarian cancer In addition to its role in CSCs, the Notch pathway has been implicated in epithelial-tomesenchymal transition (EMT) and may thereby promote tumor invasiveness and metastasis. [100] The process of EMT has been associated with chemoresistance and stem cell-like characteristics in several cancers [101], including ovarian cancer.[102-104] A recent study has demonstrated that overexpression of NICD3 in OVCA429 serous ovarian cancer cells induces EMT, as confirmed by a fibroblast-like cell morphology as well as upregulation of the mesenchymal markers Slug, Snail and smooth muscle Îą-actin and down regulation of the epithelial marker E-cadherin. The OVCA429/NICD3 cells showed increased resistance to carboplatin-induced apoptosis compared with OVCA429 control cells.[105] Although further investigation of the role of the Notch pathway in ovarian EMT is needed, these findings suggest that activation of Notch can induce EMT in serous ovarian carcinomas. Notch signaling and angiogenesis in serous ovarian cancer While Notch signaling has been linked extensively to tumor angiogenesis [106-108] in many malignancies, few studies have described a similar role of the pathway in ovarian tumor angiogenesis.[109, 110] Lu and colleagues investigated gene expression differences between endothelial cells from high-grade serous ovarian carcinomas and endothelial cells from benign ovaries using gene microarrays. Overexpression of 23 genes was found in ovarian tumor endothelial cells as compared to benign ovarian endothelial cells. Among these upregulated genes was Jagged1, and silencing of this gene with a siRNA decreased tube formation and migration of endothelial cells.[109] Other investigators observed Dll4 overexpression in tumor and endothelium in 72% of ovarian cancer samples analyzed by IHC, and increased Dll4 levels were associated with worse overall survival when compared to samples with low Dll4 expression. When DLL4 was silenced in vivo using nanoparticle delivery of a DLL4 specific siRNA to mice harboring A2780 or SKOV3ip1 cell line derived xenografts, the targeting of both tumor cells and tumor-associated mouse endothelial cells inhibited tumor growth and deregulated angiogenesis. Moreover, tumor growth was further

Notch signaling in serous ovarian cancer

inhibited when the vascular endothelial growth factor inhibitor bevacizumab was added to this treatment regimen suggesting synergy between anti-VEGF treatment and Dll4 targeting. [110] In summary, the described studies provide evidence to suggest that the Notch pathway is not only involved in epithelial ovarian tumor growth, but also plays a role in endothelial cell function and angiogenesis of serous ovarian tumors.

Therapeutic targeting of the Notch pathway in serous ovarian cancer The growing body of evidence regarding the role of Notch signaling in cancer has led to the development of different Notch pathway inhibitors, a number of which are in current clinical trials (see Table 1). Several steps in the pathway can be targeted, and established classes of inhibitors include monoclonal antibodies against Notch ligands or receptors, receptor decoys, gamma-secretase inhibitors (GSIs), peptides that block the nuclear transcriptional complex, and natural compounds.[111, 112] GSIs are the most widely studied Notch pathway targeting agents. A variety of GSIs with distinct chemical structures but similar biological activity have been developed and each inhibits signaling through all four Notch paralogs by preventing formation of the active NICD.[113] Preclinical studies in a variety of cancers have shown inhibition of tumor growth or cell proliferation by GSIs.[114-118] In early phase clinical trials of GSIs, promising anti-tumor effects in several solid malignancies have been observed despite dose-limiting toxicities evidenced mainly by gastrointestinal events.[119-122] Over 40 clinical trials investigating the efficacy of GSI therapy in solid or hematologic cancers are ongoing or have recently been completed (see Table 1 for current list of ongoing trials). A subset of these trials use GSI in combination with standard chemotherapy or other targeting agents (https://clinicaltrials.gov/, [112]). Preclinical studies of Notch inhibition with GSI in serous ovarian cancer: in vitro models Several groups have studied the in vitro effectiveness of GSIs in serous ovarian cancer. A reduction of cell proliferation and induction of apoptosis have been reported in OVCAR3 and A2780 ovarian cancer cell lines following administration of the compound GSI-1, compared with DMSO controls.[78] The same GSI was used by others who showed decreased cell proliferation post treatment in A2780 and cisplatin resistant KFr13 serous ovarian cancer cell lines which both express high levels of NICD3.[86] Moreover, it was shown that treatment of A2780 cells with the GSI DAPT decreased cell proliferation in a dose- and time-dependent manner, inhibited colony formation and induced cell cycle arrest and apoptosis while reducing Notch1 and Hes1 mRNA and protein levels.[123] In contrast with these findings, a recent

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 2

study showed unchanged proliferation rates of OVCAR3, SKOV3 and several other ovarian cancer cell lines following treatment with the GSIs Compound E, DAPT or dibenzazepine (DBZ).[94] Preclinical studies of Notch inhibition with GSI in serous ovarian cancer: in vivo models Limited studies have investigated Notch inhibition in vivo for the treatment of ovarian cancer. Using in vitro and in vivo ovarian cancer models, McAuliffe and colleagues have investigated both the anti-tumor efficacy of GSI-1 as a single agent and in combination with cisplatin, and the effects of these treatments on ovarian CSC sub-populations. These investigators observed a reduction in cell viability following GSI treatment and a synergistic response to combined GSI and cisplatin therapy in established cell lines and cultured cells derived from ascites samples of platinum resistant and platinum sensitive patients. Sensitivity to GSI was found to correlate with Notch3 protein levels, as assessed by Western blotting. SiRNA-mediated knockdown of Notch3 increased sensitivity to cisplatin in PA-1 and OVCAR3 cell lines and had no effect in SKOV3 cells which do not express detectable levels of Notch3. The described synergy of GSI and cisplatin was confirmed in vivo, using xenografts derived from these established cell lines. In addition, in vitro treatment with GSI or GSI + cisplatin decreased the side population and in vivo GSI therapy reduced both the side population and mRNA levels of the CSC markers CD44 and ALDH1, suggesting GSI is effective at eliminating CSCs.[124] The in vivo effect of single agent GSI or GSI in combination with standard chemotherapy in a patient derived xenograft (PDX) model was explored by our group using cohorts of mice harboring PDX tumors derived from either clinically platinum sensitive or clinically platinum resistant primary serous ovarian tumors. Three of four platinum sensitive tumors and one of three platinum resistant tumors showed a decrease in tumor growth following single agent GSI treatment. Moreover, combination treatment with GSI and paclitaxel led to a markedly greater reduction in tumor growth compared with paclitaxel alone and GSI alone in all platinum resistant tumors. The combination of GSI with paclitaxel and carboplatin was not more effective than paclitaxel/ carboplatin alone in platinum sensitive tumors.[125] These findings highlight a potential role for Notch pathway inhibition in addition to cytotoxic therapy in the recurrent, platinum resistant setting in serous ovarian cancer.

Notch signaling in serous ovarian cancer

Drug

Target

MK-0752

ClinicalTrials.gov n identifier γ-secretase NCT01098344 60

Delivery Disease site

Monotherapy or combination Unresectable pancreatic Combination with cancer gemcitabine Unresectable breast Combination with cancer vismodegib Neoadjuvant breast Combination with cancer carboplatin and paclitaxel

Oral

RO4929097

γ-secretase NCT01071564

Oral

RO4929097

γ-secretase NCT01238133

Oral

RO4929097 RO4929097

γ-secretase NCT01122901 γ-secretase NCT01151449 NCT01120275 NCT01232829

60 30 24 21

Oral Oral

Glioblastoma Breast cancer Melanoma Pancreatic cancer

Monotherapy Monotherapy

RO4929097

γ-secretase NCT01119599

Oral

Glioblastoma

Combination with radiation therapy and temozolomide

RO4929097

γ-secretase NCT01193881

Oral

Lung cancer

RO4929097

γ-secretase NCT01158274

Oral

RO4929097 RO4929097

γ-secretase NCT01141569 γ-secretase NCT01189240

5 13

Oral Oral

RO4929097

γ-secretase NCT01200810

Oral

RO4929097

γ-secretase NCT01175343

Oral

BMS-906024 γ-secretase NCT01653470

BMS-906024 γ-secretase NCT01292655

110 IV

BMS-906024 γ-secretase NCT01363817

BMS-986115 γ-secretase NCT01986218

Oral

PF-03084014 γ-secretase NCT01981551

Oral

Combination with erlotinib Refractory solid tumors Combination with capecitabine Renal cell cancer Monotherapy Glioblastoma Combination with bevacizumab Refractory prostate Combination with cancer bicalutamide Monotherapy Refractory ovarian, fallopian tube or peritoneal cancer Advanced or metastatic Combination with solid tumors weekly paclitaxel; 5-FU + irinotecan; carboplatin + paclitaxel Advanced or metastatic solid tumors T-cell leukemia or lymphoma Advanced or metastatic solid tumors Desmoid tumors

Monotherapy Monotherapy Monotherapy Monotherapy

Table 1. Ongoing phase I and phase II trials of therapies targeting the Notch pathway.

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 2

Clinical studies of Notch inhibition with GSI in serous ovarian cancer To date, early clinical trials have provided little data regarding the efficacy of GSIs in ovarian cancer patients. A recent phase I clinical trial using the GSI RO4929097 in a range of advanced solid tumors reported prolonged stable disease in three of nine ovarian cancer patients.[122] In other phase I studies, no clinical benefit of RO4929097 in combination with gemcitabine was found in two of two ovarian cancer patients included in the trial [119], and the GSI MK0752 was clinically ineffective as single agent therapy in three of three ovarian tumors.[120] Table 2 lists the completed phase I and phase II trials of GSIs in various solid tumors. While the only phase II trial exclusively in ovarian carcinoma assesses RO4929097 as a single agent, many other disease sites are testing GSI in combination with other biologics or cytotoxic chemotherapies. In the reported trial literature, the most clinical benefit has been observed in those trials that combine GSI with other agents suggesting a supporting therapeutic role for GSI. The fact that monotherapy has resulted in the lower published clinical benefit rates stems in part from phase I trial designs that are powered to detect toxicity, not efficacy. However, an additional contributing factor is that durable tumor control from Notch inhibition requires careful selection for tumors innately dependent on Notch signaling for proliferation. To date, no trials testing Notch pathway inhibition in patients pre-selected based on alterations in the Notch pathway have been reported. Significant preclinical data, however, seem to support such stratification as a promising approach. Future clinical studies will need to employ clinical as well as scientific endpoints to better understand the molecular characteristics of tumors that respond to therapy. Without a clear biomarker, specific biologic therapies such as GSI are unlikely to become a mainstay of therapy. In addition to biomarker discovery, more trials investigating the combination of GSI with conventional cytotoxics such as taxanes need to be conducted. Preclinical rationale exists for this combination approach as tumor cell resistance to cytotoxics and other biologic therapies, such as taxanes and antiHER2 therapies, has been linked to heightened Notch signaling.[126, 127] Since Notch may be an important escape pathway that reconstitutes the oncogenic potential of a tumor cell, Notch inhibition may be a key adjunct to conventional therapies known to be effective.[128]

γ-secretase γ-secretase

γ-secretase

MK-0752 MK-0752

MK-0752

RO4929097

NCT01232829[136]

NCT01116687[135]

NCT01131234[134]

NCT01145456[119]

NCT01198184[133]

NCT00572182[132]

ClinicalTrials.gov identifier NCT00106145[120] NCT00645333[121]

Oral

Refractory pancreatic cancer

Metastatic colorectal cancer

Solid tumors

Refractory pediatric CNS cancer

Solid tumors Breast cancer

Delivery Disease site

103 Oral 30 Oral

Monotherapy

Combination with temsirolimus Combination with gemcitabine Combination with cediranib Monotherapy

Monotherapy or combination Monotherapy Combination with docetaxel Monotherapy

Table 2. Completed phase I and phase II trials of therapies targeting the Notch pathway. CR = complete response, PR = partial response, SD = stable disease.

Target

Drug

0 (0)

1 (1) 0 (0)

CR (%)

0 (0)

1 (5)

1 (6)

0 (0)

3 (25)

6 (18)

11 (55)

4 (22)

11 (73)

2 (9)

10 (10) 9 (34)

0 (0) 11 (42) 0 (0)

SD (%)

PR (%)

Notch signaling in serous ovarian cancer

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 2

Other Notch inhibitors in serous ovarian cancer In addition to targeting of gamma-secretase activity, alternative methods of Notch pathway inhibition have been studied in ovarian cancer. Inhibition of Jag1 using siRNA constructs in the IGROV-AF1 cell line and the taxane resistant SKOV3Trip2 cell lines resulted in a reduction of cell viability as well as sensitization to docetaxel in SKOV3Trip2 cells. The same cell lines were used to generate intraperitoneal tumors in mice, and the effects of targeting Jag1 in stromal and malignant cells were evaluated by treatment of mice with either mouse specific Jag1 siRNA, human specific Jag1 siRNA or both siRNA constructs. Either siRNA alone reduced tumor growth, and the combination of mouse and human Jag1 siRNAs showed a synergistic effect in tumors derived from both cell lines. Combination treatment of SKOV3Trip2-derived tumors with human and mouse specific Jag1 siRNAs and docetaxel led to the highest decrease in tumor weight, compared with the siRNAs alone or docetaxel alone. Microvessel densities were reduced after treatment with anti-murine Jag1 siRNA, suggesting this therapy induced anti-angiogenic effects.[129] Finally, the natural compounds xanthohumol and Withaferin A inhibited cell growth and induced apoptosis and cell cycle arrest in ovarian cancer cell lines through downregulation of Notch1 (Withaferin A and xanthohumol) and Notch3 (Withaferin A).[130, 131]

Conclusion Considerable evidence supports an important oncogenic role of Notch signaling in high-grade serous ovarian cancer. Perturbation in normal regulation of Notch1 and Notch3 as well as Notch ligands, target genes and other members of the Notch pathway has been described. The many biological and clinical aspects of ovarian tumorigenesis in which aberrant Notch signaling appears to be involved include tumor initiation and progression, metastasis, resistance to chemotherapy, CSC activity, angiogenesis and EMT. Despite its functional complexity and crosstalk with other signaling cascades, the Notch pathway represents an attractive therapeutic target in ovarian cancer. Preclinical analysis of Notch inhibition suggests Notch targeting agents such as GSIs hold promise as potential treatment strategies for ovarian cancer patients, most notably in the setting of recurrence and chemoresistance. In addition, combination regimens with conventional cytotoxic therapy as well as other targeted therapies warrant further investigation.

Notch signaling in serous ovarian cancer

References 1.

Siegel R, Ma J, Zou Z, Jemal A: Cancer statistics, 2014. CA Cancer J Clin 2014, 64(1):9-29.

Hennessy BT, Coleman RL, Markman M: Ovarian cancer. Lancet 2009, 374(9698):1371-1382.

Ozols RF, Bundy BN, Greer BE, Fowler JM, Clarke-Pearson D, Burger RA, Mannel RS, DeGeest K, Hartenbach EM, Baergen R: Phase III trial of carboplatin and paclitaxel compared with cisplatin and paclitaxel in patients with optimally resected stage III ovarian cancer: a Gynecologic Oncology Group study. J Clin Oncol 2003, 21(17):3194-3200.

Armstrong DK, Bundy B, Wenzel L, Huang HQ, Baergen R, Lele S, Copeland LJ, Walker JL, Burger RA: Intraperitoneal cisplatin and paclitaxel in ovarian cancer. N Eng J Med 2006, 354(1):34-43.

Cooke SL, Brenton JD: Evolution of platinum resistance in high-grade serous ovarian cancer. Lancet Oncol 2011, 12(12):1169-1174.

Pinato DJ, Graham J, Gabra H, Sharma R: Evolving concepts in the management of drug resistant ovarian cancer: dose dense chemotherapy and the reversal of clinical platinum resistance. Cancer Treat Rev 2013, 39(2):153-160.

Kurman RJ, Shih Ie M: Molecular pathogenesis and extraovarian origin of epithelial ovarian cancer--shifting the paradigm. Hum Pathol 2011, 42(7):918-931.

Lim D, Oliva E: Precursors and pathogenesis of ovarian carcinoma. Pathology 2013, 45(3):229-242.

Kurman RJ: Origin and molecular pathogenesis of ovarian high-grade serous carcinoma. Ann Oncol 2013, 24 Suppl 10:x16-21.

10.

Banerjee S, Kaye SB: New strategies in the treatment of ovarian cancer: current clinical perspectives and future potential. Clin Cancer Res 2013, 19(5):961-968.

11.

Integrated genomic analyses of ovarian carcinoma. Nature 2011, 474(7353):609-615.

12.

Mohr OL: Character Changes Caused by Mutation of an Entire Region of a Chromosome in Drosophila. Genetics 1919, 4(3):275-282.

13.

Giniger E: Notch signaling and neural connectivity. Curr Opin Genet Dev 2012, 22(4):339-346.

14.

Artavanis-Tsakonas S, Delidakis C, Fehon RG: The Notch locus and the cell biology of neuroblast segregation. Annu Rev Cell Biol 1991, 7:427-452.

15.

Koch U, Lehal R, Radtke F: Stem cells living with a Notch. Development 2013, 140(4):689-704.

16.

Liu J, Sato C, Cerletti M, Wagers A: Notch signaling in the regulation of stem cell self-renewal and differentiation. Curr Top Dev Biol 2010, 92:367-409.

17.

Bray SJ: Notch signalling: a simple pathway becomes complex. Nat Rev Mol Cell Biol 2006, 7(9):678-689.

18.

Perdigoto CN, Bardin AJ: Sending the right signal: Notch and stem cells. Biochimica et biophysica acta 2013, 1830(2):2307-2322.

19.

Lindsell CE, Shawber CJ, Boulter J, Weinmaster G: Jagged: a mammalian ligand that activates Notch1. Cell 1995, 80(6):909-917.

20.

Shawber C, Boulter J, Lindsell CE, Weinmaster G: Jagged2: a serrate-like gene expressed during rat embryogenesis. Dev Biol 1996, 180(1):370-376.

21.

Dunwoodie SL, Henrique D, Harrison SM, Beddington RS: Mouse Dll3: a novel divergent Delta gene which may complement the function of other Delta homologues during early pattern formation in the mouse embryo. Development 1997, 124(16):3065-3076.

22.

Ikeuchi T, Sisodia SS: The Notch ligands, Delta1 and Jagged2, are substrates for presenilin-dependent “gammasecretase” cleavage. J Biol Chem 2003, 278(10):7751-7754.

23.

D’Souza B, Miyamoto A, Weinmaster G: The many facets of Notch ligands. Oncogene 2008, 27(38):51485167.

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 2

24.

Wharton KA, Johansen KM, Xu T, Artavanis-Tsakonas S: Nucleotide sequence from the neurogenic locus notch implies a gene product that shares homology with proteins containing EGF-like repeats. Cell 1985, 43(3 Pt 2):567-581.

25.

Rebay I, Fleming RJ, Fehon RG, Cherbas L, Cherbas P, Artavanis-Tsakonas S: Specific EGF repeats of Notch mediate interactions with Delta and Serrate: implications for Notch as a multifunctional receptor. Cell 1991, 67(4):687-699.

26.

Logeat F, Bessia C, Brou C, LeBail O, Jarriault S, Seidah NG, Israel A: The Notch1 receptor is cleaved constitutively by a furin-like convertase. Proc Natl Acad Sci U S A 1998, 95(14):8108-8112.

27.

Blaumueller CM, Qi H, Zagouras P, Artavanis-Tsakonas S: Intracellular cleavage of Notch leads to a heterodimeric receptor on the plasma membrane. Cell 1997, 90(2):281-291.

28.

Haines N, Irvine KD: Glycosylation regulates Notch signalling. Nature reviews Molecular cell biology 2003, 4(10):786-797.

29.

Stanley P, Okajima T: Roles of glycosylation in Notch signaling. Current topics in developmental biology 2010, 92:131-164.

30.

Mumm JS, Schroeter EH, Saxena MT, Griesemer A, Tian X, Pan DJ, Ray WJ, Kopan R: A ligand-induced extracellular cleavage regulates gamma-secretase-like proteolytic activation of Notch1. Mol Cell 2000, 5(2):197-206.

31.

Brou C, Logeat F, Gupta N, Bessia C, LeBail O, Doedens JR, Cumano A, Roux P, Black RA, Israel A: A novel proteolytic cleavage involved in Notch signaling: the role of the disintegrin-metalloprotease TACE. Mol Cell 2000, 5(2):207-216.

32.

Saxena MT, Schroeter EH, Mumm JS, Kopan R: Murine notch homologs (N1-4) undergo presenilin-dependent proteolysis. J Biol Chem 2001, 276(43):40268-40273.

33.

Tolia A, De Strooper B: Structure and function of gamma-secretase. Semin Cell Dev Biol 2009, 20(2):211-218.

34.

Kovall RA: More complicated than it looks: assembly of Notch pathway transcription complexes. Oncogene 2008, 27(38):5099-5109.

35.

Kopan R, Ilagan MX: The canonical Notch signaling pathway: unfolding the activation mechanism. Cell 2009, 137(2):216-233.

36.

Wu L, Aster JC, Blacklow SC, Lake R, Artavanis-Tsakonas S, Griffin JD: MAML1, a human homologue of Drosophila mastermind, is a transcriptional co-activator for NOTCH receptors. Nat Genet 2000, 26(4):484489.

37.

Iso T, Kedes L, Hamamori Y: HES and HERP families: multiple effectors of the Notch signaling pathway. J Cell Physiol 2003, 194(3):237-255.

38.

Stifani S, Blaumueller CM, Redhead NJ, Hill RE, Artavanis-Tsakonas S: Human homologs of a Drosophila Enhancer of split gene product define a novel family of nuclear proteins. Nat Genet 1992, 2(2):119-127.

39.

Maier MM, Gessler M: Comparative analysis of the human and mouse Hey1 promoter: Hey genes are new Notch target genes. Biochem Biophys Res Commun 2000, 275(2):652-660.

40.

Ronchini C, Capobianco AJ: Induction of cyclin D1 transcription and CDK2 activity by Notch(ic): implication for cell cycle disruption in transformation by Notch(ic). Mol Cell Biol 2001, 21(17):5925-5934.

41.

Oswald F, Liptay S, Adler G, Schmid RM: NF-kappaB2 is a putative target gene of activated Notch-1 via RBPJkappa. Mol Cell Biol 1998, 18(4):2077-2088.

42.

Weng AP, Millholland JM, Yashiro-Ohtani Y, Arcangeli ML, Lau A, Wai C, Del Bianco C, Rodriguez CG, Sai H, Tobias J et al: c-Myc is an important direct target of Notch1 in T-cell acute lymphoblastic leukemia/lymphoma. Genes Dev 2006, 20(15):2096-2109.

43.

Choi JW, Pampeno C, Vukmanovic S, Meruelo D: Characterization of the transcriptional expression of Notch-1 signaling pathway members, Deltex and HES-1, in developing mouse thymocytes. Dev Comp Immunol 2002, 26(6):575-588.

44.

Hurlbut GD, Kankel MW, Lake RJ, Artavanis-Tsakonas S: Crossing paths with Notch in the hyper-network. Curr Opin Cell Biol 2007, 19(2):166-175.

Notch signaling in serous ovarian cancer

45.

Brechbiel J, Miller-Moslin K, Adjei AA: Crosstalk between hedgehog and other signaling pathways as a basis for combination therapies in cancer. Cancer Treat Rev 2014, 40(6):750-759.

46.

Yamaguchi H, Chang SS, Hsu JL, Hung MC: Signaling cross-talk in the resistance to HER family receptor targeted therapy. Oncogene 2014, 33(9):1073-1081.

47.

Duncan AW, Rattis FM, DiMascio LN, Congdon KL, Pazianos G, Zhao C, Yoon K, Cook JM, Willert K, Gaiano N et al: Integration of Notch and Wnt signaling in hematopoietic stem cell maintenance. Nat Immunol 2005, 6(3):314-322.

48.

Axelrod JD, Matsuno K, Artavanis-Tsakonas S, Perrimon N: Interaction between Wingless and Notch signaling pathways mediated by dishevelled. Science 1996, 271(5257):1826-1832.

49.

Cooper MT, Bray SJ: R7 photoreceptor specification requires Notch activity. Curr Biol: CB 2000, 10(23):15071510.

50.

Berset T, Hoier EF, Battu G, Canevascini S, Hajnal A: Notch inhibition of RAS signaling through MAP kinase phosphatase LIP-1 during C. elegans vulval development. Science 2001, 291(5506):1055-1058.

51.

Sundaram MV: The love-hate relationship between Ras and Notch. Genes Dev 2005, 19(16):1825-1839.

52.

Lawson ND, Vogel AM, Weinstein BM: sonic hedgehog and vascular endothelial growth factor act upstream of the Notch pathway during arterial endothelial differentiation. Dev Cell 2002, 3(1):127-136.

53.

Androutsellis-Theotokis A, Leker RR, Soldner F, Hoeppner DJ, Ravin R, Poser SW, Rueger MA, Bae SK, Kittappa R, McKay RD: Notch signalling regulates stem cell numbers in vitro and in vivo. Nature 2006, 442(7104):823826.

54.

McKenzie G, Ward G, Stallwood Y, Briend E, Papadia S, Lennard A, Turner M, Champion B, Hardingham GE: Cellular Notch responsiveness is defined by phosphoinositide 3-kinase-dependent signals. BMC Cell Biol 2006, 7:10.

55.

Cornejo MG, Mabialah V, Sykes SM, Khandan T, Lo Celso C, Lopez CK, Rivera-Munoz P, Rameau P, Tothova Z, Aster JC et al: Crosstalk between NOTCH and AKT signaling during murine megakaryocyte lineage specification. Blood 2011, 118(5):1264-1273.

56.

de Celis JF, Bray S, Garcia-Bellido A: Notch signalling regulates veinlet expression and establishes boundaries between veins and interveins in the Drosophila wing. Development 1997, 124(10):1919-1928.

57.

Culi J, Martin-Blanco E, Modolell J: The EGF receptor and N signalling pathways act antagonistically in Drosophila mesothorax bristle patterning. Development 2001, 128(2):299-308.

58.

Chen Y, Fischer WH, Gill GN: Regulation of the ERBB-2 promoter by RBPJkappa and NOTCH. J Biol Chem 1997, 272(22):14110-14114.

59.

Ellisen LW, Bird J, West DC, Soreng AL, Reynolds TC, Smith SD, Sklar J: TAN-1, the human homolog of the Drosophila notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms. Cell 1991, 66(4):649-661.

60.

Weng AP, Ferrando AA, Lee W, Morris JPt, Silverman LB, Sanchez-Irizarry C, Blacklow SC, Look AT, Aster JC: Activating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia. Science 2004, 306(5694):269271.

61.

Stylianou S, Clarke RB, Brennan K: Aberrant activation of notch signaling in human breast cancer. Cancer Res 2006, 66(3):1517-1525.

62.

Santagata S, Demichelis F, Riva A, Varambally S, Hofer MD, Kutok JL, Kim R, Tang J, Montie JE, Chinnaiyan AM et al: JAGGED1 expression is associated with prostate cancer metastasis and recurrence. Cancer Res 2004, 64(19):6854-6857.

63.

Mullendore ME, Koorstra JB, Li YM, Offerhaus GJ, Fan X, Henderson CM, Matsui W, Eberhart CG, Maitra A, Feldmann G: Ligand-dependent Notch signaling is involved in tumor initiation and tumor maintenance in pancreatic cancer. Clin Cancer Res 2009, 15(7):2291-2301.

64.

Purow BW, Haque RM, Noel MW, Su Q, Burdick MJ, Lee J, Sundaresan T, Pastorino S, Park JK, Mikolaenko I et al: Expression of Notch-1 and its ligands, Delta-like-1 and Jagged-1, is critical for glioma cell survival and proliferation. Cancer Res 2005, 65(6):2353-2363.

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 2

65.

Westhoff B, Colaluca IN, Dâ&#x20AC;&#x2122;Ario G, Donzelli M, Tosoni D, Volorio S, Pelosi G, Spaggiari L, Mazzarol G, Viale G et al: Alterations of the Notch pathway in lung cancer. Proc Natl Acad Sci U S A 2009, 106(52):22293-22298.

66.

Sun W, Gaykalova DA, Ochs MF, Mambo E, Arnaoutakis D, Liu Y, Loyo M, Agrawal N, Howard J, Li R et al: Activation of the NOTCH pathway in head and neck cancer. Cancer Res 2014, 74(4):1091-1104.

67.

Fre S, Pallavi SK, Huyghe M, Lae M, Janssen KP, Robine S, Artavanis-Tsakonas S, Louvard D: Notch and Wnt signals cooperatively control cell proliferation and tumorigenesis in the intestine. Proc Natl Acad Sci U S A 2009, 106(15):6309-6314.

68.

Fabbri G, Rasi S, Rossi D, Trifonov V, Khiabanian H, Ma J, Grunn A, Fangazio M, Capello D, Monti S et al: Analysis of the chronic lymphocytic leukemia coding genome: role of NOTCH1 mutational activation. J Exp Med 2011, 208(7):1389-1401.

69.

Jundt F, Anagnostopoulos I, Forster R, Mathas S, Stein H, Dorken B: Activated Notch1 signaling promotes tumor cell proliferation and survival in Hodgkin and anaplastic large cell lymphoma. Blood 2002, 99(9):33983403.

70.

Kridel R, Meissner B, Rogic S, Boyle M, Telenius A, Woolcock B, Gunawardana J, Jenkins C, Cochrane C, Ben-Neriah S et al: Whole transcriptome sequencing reveals recurrent NOTCH1 mutations in mantle cell lymphoma. Blood 2012, 119(9):1963-1971.

71.

Jundt F, Probsting KS, Anagnostopoulos I, Muehlinghaus G, Chatterjee M, Mathas S, Bargou RC, Manz R, Stein H, Dorken B: Jagged1-induced Notch signaling drives proliferation of multiple myeloma cells. Blood 2004, 103(9):3511-3515.

72.

Ranganathan P, Weaver KL, Capobianco AJ: Notch signalling in solid tumours: a little bit of everything but not all the time. Nat Rev Cancer 2011, 11(5):338-351.

73.

South AP, Cho RJ, Aster JC: The double-edged sword of Notch signaling in cancer. Semin Cell Dev Biol 2012, 23(4):458-464.

74.

Nicolas M, Wolfer A, Raj K, Kummer JA, Mill P, van Noort M, Hui CC, Clevers H, Dotto GP, Radtke F: Notch1 functions as a tumor suppressor in mouse skin. Nat Genet 2003, 33(3):416-421.

75.

Wang NJ, Sanborn Z, Arnett KL, Bayston LJ, Liao W, Proby CM, Leigh IM, Collisson EA, Gordon PB, Jakkula L et al: Loss-of-function mutations in Notch receptors in cutaneous and lung squamous cell carcinoma. Proc Natl Acad Sci U S A 2011, 108(43):17761-17766.

76.

Lu KH, Patterson AP, Wang L, Marquez RT, Atkinson EN, Baggerly KA, Ramoth LR, Rosen DG, Liu J, Hellstrom I et al: Selection of potential markers for epithelial ovarian cancer with gene expression arrays and recursive descent partition analysis. Clin Cancer Res 2004, 10(10):3291-3300.

77.

Euer NI, Kaul S, Deissler H, Mobus VJ, Zeillinger R, Weidle UH: Identification of L1CAM, Jagged2 and Neuromedin U as ovarian cancer-associated antigens. Oncol Rep 2005, 13(3):375-387.

78.

Park JT, Li M, Nakayama K, Mao TL, Davidson B, Zhang Z, Kurman RJ, Eberhart CG, Shih Ie M, Wang TL: Notch3 gene amplification in ovarian cancer. Cancer Res 2006, 66(12):6312-6318.

79.

Nakayama K, Nakayama N, Jinawath N, Salani R, Kurman RJ, Shih Ie M, Wang TL: Amplicon profiles in ovarian serous carcinomas. Int J Cancer 2007, 120(12):2613-2617.

80.

Choi JH, Park JT, Davidson B, Morin PJ, Shih Ie M, Wang TL: Jagged-1 and Notch3 juxtacrine loop regulates ovarian tumor growth and adhesion. Cancer Res 2008, 68(14):5716-5723.

81.

Park JT, Shih Ie M, Wang TL: Identification of Pbx1, a potential oncogene, as a Notch3 target gene in ovarian cancer. Cancer Res 2008, 68(21):8852-8860.

82.

Chen X, Thiaville MM, Chen L, Stoeck A, Xuan J, Gao M, Shih Ie M, Wang TL: Defining NOTCH3 target genes in ovarian cancer. Cancer Res 2012, 72(9):2294-2303.

83.

Ivan C, Hu W, Bottsford-Miller J, Zand B, Dalton HJ, Liu T, Huang J, Nick AM, Lopez-Berestein G, Coleman RL et al: Epigenetic analysis of the Notch superfamily in high-grade serous ovarian cancer. Gynecol Oncol 2013, 128(3):506-511.

84.

Jung SG, Kwon YD, Song JA, Back MJ, Lee SY, Lee C, Hwang YY, An HJ: Prognostic significance of Notch 3 gene expression in ovarian serous carcinoma. Cancer Sci 2010, 101(9):1977-1983.

Notch signaling in serous ovarian cancer

85.

Park JT, Chen X, Trope CG, Davidson B, Shih Ie M, Wang TL: Notch3 overexpression is related to the recurrence of ovarian cancer and confers resistance to carboplatin. Am J Path 2010, 177(3):1087-1094.

86.

Rahman MT, Nakayama K, Rahman M, Katagiri H, Katagiri A, Ishibashi T, Ishikawa M, Iida K, Nakayama S, Otsuki Y et al: Notch3 overexpression as potential therapeutic target in advanced stage chemoresistant ovarian cancer. Am J Clin Pathol 2012, 138(4):535-544.

87.

Hopfer O, Zwahlen D, Fey MF, Aebi S: The Notch pathway in ovarian carcinomas and adenomas. Br J Cancer 2005, 93(6):709-718.

88.

Rose SL, Kunnimalaiyaan M, Drenzek J, Seiler N: Notch 1 signaling is active in ovarian cancer. Gynecol Oncol 2010, 117(1):130-133.

89.

Wang M, Wang J, Wang L, Wu L, Xin X: Notch1 expression correlates with tumor differentiation status in ovarian carcinoma. Med Oncol 2010, 27(4):1329-1335.

90.

Kluk MJ, Ashworth T, Wang H, Knoechel B, Mason EF, Morgan EA, Dorfman D, Pinkus G, Weigert O, Hornick JL et al: Gauging NOTCH1 Activation in Cancer Using Immunohistochemistry. PloS one 2013, 8(6):e67306.

91.

Oktem G, Sanci M, Bilir A, Yildirim Y, Kececi SD, Ayla S, Inan S: Cancer stem cell and embryonic developmentassociated molecules contribute to prognostic significance in ovarian cancer. Int J Gyn Cancer 2012, 22(1):2329.

92.

Jordan CT, Guzman ML, Noble M: Cancer stem cells. N Engl J Med 2006, 355(12):1253-1261.

93.

Oâ&#x20AC;&#x2122;Connor ML, Xiang D, Shigdar S, Macdonald J, Li Y, Wang T, Pu C, Wang Z, Qiao L, Duan W: Cancer stem cells: A contentious hypothesis now moving forward. Cancer Lett 2014, 344(2):180-187.

94.

Shah MM, Zerlin M, Li BY, Herzog TJ, Kitajewski JK, Wright JD: The role of Notch and gamma-secretase inhibition in an ovarian cancer model. Anticancer Res 2013, 33(3):801-808.

95.

Foster R, Buckanovich RJ, Rueda BR: Ovarian cancer stem cells: working towards the root of stemness. Cancer Lett 2013, 338(1):147-157.

96.

Steg AD, Bevis KS, Katre AA, Ziebarth A, Dobbin ZC, Alvarez RD, Zhang K, Conner M, Landen CN: Stem cell pathways contribute to clinical chemoresistance in ovarian cancer. Clin Cancer Res 2012, 18(3):869-881.

97.

Rizzo S, Hersey JM, Mellor P, Dai W, Santos-Silva A, Liber D, Luk L, Titley I, Carden CP, Box G et al: Ovarian cancer stem cell-like side populations are enriched following chemotherapy and overexpress EZH2. Mol Cancer Ther 2011, 10(2):325-335.

98.

Zhang S, Balch C, Chan MW, Lai HC, Matei D, Schilder JM, Yan PS, Huang TH, Nephew KP: Identification and characterization of ovarian cancer-initiating cells from primary human tumors. Cancer Res 2008, 68(11):43114320.

99.

Vathipadiekal V, Saxena D, Mok SC, Hauschka PV, Ozbun L, Birrer MJ: Identification of a potential ovarian cancer stem cell gene expression profile from advanced stage papillary serous ovarian cancer. PloS one 2012, 7(1):e29079.

100. Espinoza I, Miele L: Deadly crosstalk: Notch signaling at the intersection of EMT and cancer stem cells. Cancer Lett 2013, 341(1):41-45. 101. Singh A, Settleman J: EMT, cancer stem cells and drug resistance: an emerging axis of evil in the war on cancer. Oncogene 2010, 29(34):4741-4751. 102. Ahmed N, Abubaker K, Findlay J, Quinn M: Epithelial mesenchymal transition and cancer stem cell-like phenotypes facilitate chemoresistance in recurrent ovarian cancer. Curr Cancer Drug Tar 2010, 10(3):268278. 103. Kajiyama H, Shibata K, Terauchi M, Yamashita M, Ino K, Nawa A, Kikkawa F: Chemoresistance to paclitaxel induces epithelial-mesenchymal transition and enhances metastatic potential for epithelial ovarian carcinoma cells. Int J Oncol 2007, 31(2):277-283. 104. Marchini S, Fruscio R, Clivio L, Beltrame L, Porcu L, Nerini IF, Cavalieri D, Chiorino G, Cattoretti G, Mangioni C et al: Resistance to platinum-based chemotherapy is associated with epithelial to mesenchymal transition in epithelial ovarian cancer. Eur J Cancer 2013, 49(2):520-530.

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 2

105. Gupta N, Xu Z, El-Sehemy A, Steed H, Fu Y: Notch3 induces epithelial-mesenchymal transition and attenuates carboplatin-induced apoptosis in ovarian cancer cells. Gynecol Oncol 2013, 130(1):200-206. 106. Li JL, Sainson RC, Shi W, Leek R, Harrington LS, Preusser M, Biswas S, Turley H, Heikamp E, Hainfellner JA et al: Delta-like 4 Notch ligand regulates tumor angiogenesis, improves tumor vascular function, and promotes tumor growth in vivo. Cancer Res 2007, 67(23):11244-11253. 107. Patel NS, Li JL, Generali D, Poulsom R, Cranston DW, Harris AL: Up-regulation of delta-like 4 ligand in human tumor vasculature and the role of basal expression in endothelial cell function. Cancer Res 2005, 65(19):86908697. 108. Benedito R, Roca C, Sorensen I, Adams S, Gossler A, Fruttiger M, Adams RH: The notch ligands Dll4 and Jagged1 have opposing effects on angiogenesis. Cell 2009, 137(6):1124-1135. 109. Lu C, Bonome T, Li Y, Kamat AA, Han LY, Schmandt R, Coleman RL, Gershenson DM, Jaffe RB, Birrer MJ et al: Gene alterations identified by expression profiling in tumor-associated endothelial cells from invasive ovarian carcinoma. Cancer Res 2007, 67(4):1757-1768. 110. Hu W, Lu C, Dong HH, Huang J, Shen DY, Stone RL, Nick AM, Shahzad MM, Mora E, Jennings NB et al: Biological roles of the Delta family Notch ligand Dll4 in tumor and endothelial cells in ovarian cancer. Cancer Res 2011, 71(18):6030-6039. 111. Espinoza I, Miele L: Notch inhibitors for cancer treatment. Pharmacol Ther 2013, 139(2):95-110. 112. Takebe N, Nguyen D, Yang SX: Targeting notch signaling pathway in cancer: clinical development advances and challenges. Pharmacol Ther 2014, 141(2):140-149. 113. Olsauskas-Kuprys R, Zlobin A, Osipo C: Gamma secretase inhibitors of Notch signaling. OncoTargets and therapy 2013, 6:943-955. 114. Lewis HD, Leveridge M, Strack PR, Haldon CD, Oâ&#x20AC;&#x2122;Neil J, Kim H, Madin A, Hannam JC, Look AT, Kohl N et al: Apoptosis in T cell acute lymphoblastic leukemia cells after cell cycle arrest induced by pharmacological inhibition of notch signaling. Chem Biol 2007, 14(2):209-219. 115. Chen J, Kesari S, Rooney C, Strack PR, Shen H, Wu L, Griffin JD: Inhibition of notch signaling blocks growth of glioblastoma cell lines and tumor neurospheres. Genes Cancer 2010, 1(8):822-835. 116. Mizuma M, Rasheed ZA, Yabuuchi S, Omura N, Campbell NR, de Wilde RF, De Oliveira E, Zhang Q, Puig O, Matsui W et al: The gamma secretase inhibitor MRK-003 attenuates pancreatic cancer growth in preclinical models. Mol Cancer Ther 2012, 11(9):1999-2009. 117. Meng RD, Shelton CC, Li YM, Qin LX, Notterman D, Paty PB, Schwartz GK: gamma-Secretase inhibitors abrogate oxaliplatin-induced activation of the Notch-1 signaling pathway in colon cancer cells resulting in enhanced chemosensitivity. Cancer Res 2009, 69(2):573-582. 118. Konishi J, Kawaguchi KS, Vo H, Haruki N, Gonzalez A, Carbone DP, Dang TP: Gamma-secretase inhibitor prevents Notch3 activation and reduces proliferation in human lung cancers. Cancer Res 2007, 67(17):80518057. 119. Richter S, Bedard PL, Chen EX, Clarke BA, Tran B, Hotte SJ, Stathis A, Hirte HW, Razak AR, Reedijk M et al: A phase I study of the oral gamma secretase inhibitor R04929097 in combination with gemcitabine in patients with advanced solid tumors (PHL-078/CTEP 8575). Invest New Drugs 2014, 32(2):243-249. 120. Krop I, Demuth T, Guthrie T, Wen PY, Mason WP, Chinnaiyan P, Butowski N, Groves MD, Kesari S, Freedman SJ et al: Phase I pharmacologic and pharmacodynamic study of the gamma secretase (Notch) inhibitor MK-0752 in adult patients with advanced solid tumors. J Clin Oncol 2012, 30(19):2307-2313. 121. Schott AF, Landis MD, Dontu G, Griffith KA, Layman RM, Krop I, Paskett LA, Wong H, Dobrolecki LE, Lewis MT et al: Preclinical and clinical studies of gamma secretase inhibitors with docetaxel on human breast tumors. Clin Cancer Res 2013, 19(6):1512-1524. 122. Tolcher AW, Messersmith WA, Mikulski SM, Papadopoulos KP, Kwak EL, Gibbon DG, Patnaik A, Falchook GS, Dasari A, Shapiro GI et al: Phase I study of RO4929097, a gamma secretase inhibitor of Notch signaling, in patients with refractory metastatic or locally advanced solid tumors. J Clin Oncol 2012, 30(19):2348-2353.

Notch signaling in serous ovarian cancer

123. Wang M, Ma X, Wang J, Wang L, Wang Y: Pretreatment with the gamma-secretase inhibitor DAPT sensitizes drug-resistant ovarian cancer cells to cisplatin by downregulation of Notch signaling. Int J Oncol 2014, 44(4):1401-1409. 124. McAuliffe SM, Morgan SL, Wyant GA, Tran LT, Muto KW, Chen YS, Chin KT, Partridge JC, Poole BB, Cheng KH et al: Targeting Notch, a key pathway for ovarian cancer stem cells, sensitizes tumors to platinum therapy. Proc Natl Acad Sci U S A 2012, 109(43):E2939-2948. 125. Groeneweg JW, DiGloria CM, Yuan J, Richardson WS, Growdon WB, Sathyanarayanan S, Foster R, Rueda BR: Inhibition of Notch signaling in combination with paclitaxel reduces platinum-resistant ovarian tumor growth. Front Oncol 2014. 126. Domingo-Domenech J, Vidal SJ, Rodriguez-Bravo V, Castillo-Martin M, Quinn SA, Rodriguez-Barrueco R, Bonal DM, Charytonowicz E, Gladoun N, de la Iglesia-Vicente J et al: Suppression of acquired docetaxel resistance in prostate cancer through depletion of notch- and hedgehog-dependent tumor-initiating cells. Cancer Cell 2012, 22(3):373-388. 127. Osipo C, Patel P, Rizzo P, Clementz AG, Hao L, Golde TE, Miele L: ErbB-2 inhibition activates Notch-1 and sensitizes breast cancer cells to a gamma-secretase inhibitor. Oncogene 2008, 27(37):5019-5032. 128. Al-Hussaini H, Subramanyam D, Reedijk M, Sridhar SS: Notch signaling pathway as a therapeutic target in breast cancer. Mol Cancer Ther 2011, 10(1):9-15. 129. Steg AD, Katre AA, Goodman B, Han HD, Nick AM, Stone RL, Coleman RL, Alvarez RD, Lopez-Berestein G, Sood AK et al: Targeting the notch ligand JAGGED1 in both tumor cells and stroma in ovarian cancer. Clin Cancer Res 2011, 17(17):5674-5685. 130. Drenzek JG, Seiler NL, Jaskula-Sztul R, Rausch MM, Rose SL: Xanthohumol decreases Notch1 expression and cell growth by cell cycle arrest and induction of apoptosis in epithelial ovarian cancer cell lines. Gynecol Oncol 2011, 122(2):396-401. 131. Zhang X, Samadi AK, Roby KF, Timmermann B, Cohen MS: Inhibition of cell growth and induction of apoptosis in ovarian carcinoma cell lines CaOV3 and SKOV3 by natural withanolide Withaferin A. Gynecol Oncol 2012, 124(3):606-612. 132. Fouladi M, Stewart CF, Olson J, Wagner LM, Onar-Thomas A, Kocak M, Packer RJ, Goldman S, Gururangan S, Gajjar A, Demuth T, Kun LE, Boyett JM, Gilbertson RJ: Phase I trial of MK-0752 in children with refractory CNS malignancies: a pediatric brain tumor consortium study. J Clin Oncol 2011, 29:3529–3534. 133. Diaz-Padilla I, Hirte H, Oza AM, Clarke BA, Cohen B, Reedjik M, Zhang T, Kamel-Reid S, Ivy SP, Hotte SJ, Razak AA, Chen EX, Brana I, Wizemann M, Wang L, Siu LL, Bedard PL: A phase Ib combination study of RO4929097, a gamma-secretase inhibitor, and temsirolimus in patients with advanced solid tumors. Invest New Drugs 2013, 31:1182–1191. 134. Sahebjam S, Bedard PL, Castonguay V, Chen Z, Reedijk M, Liu G, Cohen B, Zhang WJ, Clarke B, Zhang T, KamelReid S, Chen H, Ivy SP, Razak AR, Oza AM, Chen EX, Hirte HW, McGarrity A, Wang L, Siu LL, Hotte SJ: A phase I study of the combination of ro4929097 and cediranib in patients with advanced solid tumours (PJC-004/NCI 8503). Br J Cancer 2013, 109:943–949. 135. Strosberg JR, Yeatman T, Weber J, Coppola D, Schell MJ, Han G, Almhanna K, Kim R, Valone T, Jump H, Sullivan D: A phase II study of RO4929097 in metastatic colorectal cancer. Eur J Cancer 2012, 48:997–1003. 136. De Jesus-Acosta A, Laheru D, Maitra A, Arcaroli J, Rudek MA, Dasari A, Blatchford PJ, Quackenbush K, Messersmith W: A phase II study of the gamma secretase inhibitor RO4929097 in patients with previously treated metastatic pancreatic adenocarcinoma. Invest New Drugs 2014.

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter

Inhibition of Notch signaling in combination with paclitaxel reduces platinum resistant ovarian tumor growth

Jolijn W. Groeneweg1,2, Celeste M. DiGloria1, Jing Yuan4, William S. Richardson1, Whitfield B. Growdon1,2,3, Sriram Sathyanarayanan4, Rosemary Foster1,2,3, Bo R. Rueda1,2,3

Vincent Center for Reproductive Biology, Department of Obstetrics and Gynecology, Massachusetts General Hospital, Boston, MA, United States

Harvard Medical School, Boston, MA, United States

Division of Gynecologic Oncology, Department of Obstetrics and Gynecology, Massachusetts General Hospital, Boston, MA, United States

Merck Research Laboratories, Boston, MA, United States

Frontiers in Oncology 2014;4:171

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 3

Abstract Objective: Ovarian cancer (OvCa) is the most lethal gynecologic malignancy in the United States because of chemoresistant recurrent disease. Our objective was to investigate the efficacy of inhibiting the Notch pathway with a gamma-secretase inhibitor (GSI) in an OvCa patient derived xenograft model as a single agent therapy and in combination with standard chemotherapy. Methods: Immunocompromised mice bearing xenografts derived from clinically platinum sensitive human ovarian serous carcinomas were treated with vehicle, GSI (MRK-003) alone, paclitaxel and carboplatin (P/C) alone, or the combination of GSI and P/C. Mice bearing platinum resistant xenografts were given GSI with or without paclitaxel. Gene transcript levels of the Notch pathway target Hes1 were analyzed using RT-PCR. Notch1 and Notch3 protein levels were evaluated. The Wilcoxon rank-sum test was used to assess significance between the different treatment groups. Results: Expression of Notch1 and 3 was variable. GSI alone decreased tumor growth in two of three platinum sensitive ovarian tumors (p < 0.05), as well as in one of three platinum resistant tumors (p = 0.04). The combination of GSI and paclitaxel was significantly more effective than GSI alone and paclitaxel alone in all platinum resistant ovarian tumors (all p <0.05). The addition of GSI did not alter the effect of P/C in platinum sensitive tumors. Interestingly, although the response of each tumor to chronic GSI exposure did not correlate with its endogenous level of Notch expression, GSI did negatively affect Notch signaling in an acute setting. Conclusion: Inhibiting the Notch signaling cascade with a GSI reduces primary human xenograft growth in vivo. GSI synergized with conventional cytotoxic chemotherapy only in the platinum resistant OvCa models with single agent paclitaxel. These findings suggest inhibition of the Notch pathway in concert with taxane therapy may hold promise for treatment of platinum resistant OvCa.

Notch inhibition in ovarian cancer

Introduction Ovarian cancer represents the second most common, and most lethal gynecologic malignancy in the United States. By the end of 2013, it is estimated that over 22,000 women will have been diagnosed with ovarian cancer and more than 15,000 patients will have succumbed to the disease.[1] The high death rate is due in part to the fact that the majority of patients present with advanced stage disease possibly due to a lack of screening strategies that effectively detect the cancer in early stages. The most common subtype is high grade serous carcinoma (70%), followed by endometrioid and clear cell variants.[2] Despite the histologic variation, the current treatment regimen includes cytoreductive surgery as well as six cycles of taxane and platinum based chemotherapy delivered IV or IP.[3, 4] While 70-80% of patients respond to this first line chemotherapy, recurrences occur frequently and a significant majority of those patients develop chemoresistant disease.[5, 6] The overall prognosis of patients diagnosed with ovarian cancer therefore remains poor, with a five-year survival rate of approximately 50%.[4] Insights into key molecular pathways that are overexpressed in ovarian cancer and contribute to tumor progression, recurrence and chemoresistance may lead to novel therapies that can improve the treatment strategies for these women. The Notch signaling cascade has been implicated in numerous malignancies [7-11], and is one of the most altered pathways in serous ovarian cancer.[2] Notch signaling is involved in the regulation of proliferation, differentiation, cell fate and survival and plays an important role in embryonic development as well as in self-renewal of adult stem/progenitor cells. [12-14] Activation of the Notch signaling cascade occurs through binding of one of four Notch receptors (Notch1-4) with one of its ligands (Jagged and Delta-like) on a neighboring cell. Sequential proteolytic cleavage of the Notch receptor by ADAM (a disintegrin and metalloprotease) and Îł-secretase leads to the release of the Notch intracellular domain (NICD). This active fragment subsequently translocates to the nucleus, where it activates transcription of target genes including members of the HES and HEY families.[12, 15] Recent studies have demonstrated expression of the Notch pathway in many malignancies including breast, intestinal, pancreatic, brain and ovarian cancer.[10, 16-21] Genomic analyses of ovarian carcinomas as part of The Cancer Genome Atlas Project showed alteration of Notch signaling in 22% of analyzed tumors.[2] In addition, Notch1 and Notch3 RNA transcript and protein are highly expressed in ovarian carcinomas [22-27] and elevated expression correlates with resistance to chemotherapy and decreased survival.[28-30] Investigators

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 3

have hypothesized that Notch signaling may promote the activity of a tumor initiating cell population that can sustain the growth of ovarian tumors despite cytotoxic therapies that halt the progression of actively proliferating cancer cells.[31-33] While this hypothesis is controversial, it would provide rationale for combining Notch pathway inhibition with conventional cytotoxic therapy. Targeting of the Notch pathway is currently being investigated in a variety of cancers, with Îł-secretase inhibitors (GSI) being the most widely used Notch inhibitors.[34, 35] Few phase I and II clinical trials have reported GSI anti-tumor activity though these studies have included only a few women with ovarian cancer. Previous pre-clinical studies have shown that inhibition of Notch signaling blocks the growth of both ovarian cancer cell lines in vitro and cell line derived xenografts in vivo.[36-38] In addition to inhibition of cell proliferation and induction of cell death, treatment with GSI is associated with an increased sensitivity of ovarian cancer cell lines to platinum therapy [39] supporting the concept that treatment with Notch antagonists may be relevant in a recurrent disease setting.[28] In the current study, we analyzed the contribution of the Notch pathway to the pathobiology of serous ovarian cancer. We assessed the expression of specific members of the Notch family and tested the anti-tumor activity of the GSI MRK-003 against patient derived xenografts (PDXs) generated from serous carcinomas of the ovary or peritoneum. The preclinical efficacy of MRK-003 has been determined in several human cancers [8, 9, 34, 40-43] and we wanted to assess the effectiveness of this GSI as a single agent and in combination with standard cytotoxic chemotherapy in a cohort of clinically platinum sensitive and resistant ovarian tumors. Treatment of mice harboring the ovarian tumor xenografts with MRK-003 resulted in reduced tumor growth in a subset of the experiments. Combination cytotoxic chemotherapy and GSI demonstrated synergistic activity only in those platinum resistant tumors suggesting Notch pathway inhibition may be more effective in the recurrent and refractory setting.

Methods Generation and propagation of ovarian cancer xenografts Our patient derived xenograft (PDX) model utilizing primary human ovarian tumors has been described previously.[44] Briefly, excess serous ovarian cancer tissue or ascites was obtained at the time of surgery from patients who had given informed consent to participate

Notch inhibition in ovarian cancer

in an Institutional Review Board approved tissue collection protocol. Following enzymatic processing, tumor derived single cell suspensions were depleted of hematopoietic and endothelial cells, resuspended in PBS, mixed with Matrigel (1:1) and injected subcutaneously (s.c.) in female NOD/SCID mice. The range of cells injected was 7.5 x 105 to 1.5 x 106 in each animal. Tumor formation in the injected animals was regularly monitored and tumors were harvested from euthanized animals when they reached a diameter of 1-2 cm. The harvested xenografts were then enzymatically processed, depleted of H-2Kd positive mouse cells and injected s.c. into NOD/SCID mice as described above. Using this transplantation system, cohorts of 15 - 40 mice injected with ovarian cancer cells derived from a single patient were generated and subsequently used to perform treatment experiments. Immunohistochemical analysis Notch1 and Notch3 protein expression in formaldehyde fixed and paraffin embedded sections of primary and xenograft ovarian tumors were analyzed by immunohistochemistry (IHC) using a mouse monoclonal anti-Notch1 antibody (Novus Biologicals) or a rabbit polyclonal anti-Notch3 antibody (Abgent). Non-specific binding of antibody was blocked by either the Vector Laboratories M.O.M. kit (in the case of Notch1) or 5% normal goat serum in PBS with 0.1% Triton X (Notch3) followed by incubation with the relevant primary antibody and the appropriate biotinylated secondary antibody. Subsequent treatment with Vectastain ABC reagents (Vector Laboratories), visualization with 3,3â&#x20AC;&#x2122;-diaminobenzidine chromogen (DAB, Dako), and counterstaining with hematoxylin were performed. Immunoblotting Whole cell lysates were prepared from frozen xenograft samples or cell lines using Mammalian Protein Extraction Reagent (Thermo Scientific) lysis buffer supplemented with inhibitors of endogenous protease, kinase and phosphatase activity (all obtained from SigmaAldrich). Twenty micrograms of protein from each sample were separated on 7.5% or 10% polyacrylamide gels and transferred to a PVDF membrane. Following transfer, membranes were blocked with 5% milk in 1X TBS, 0.1% Tween-20 (TBST) and incubated in diluted (1:1000) primary antibody overnight, according to the manufacturerâ&#x20AC;&#x2122;s recommendations. Primary antibodies used were a rabbit monoclonal anti-Notch1 antibody, a rabbit monoclonal anti-cleaved Notch1 (Val1744) antibody, and a rabbit monoclonal anti-Notch3 antibody (Cell Signaling). Membranes were then incubated with a horseradish peroxidase (HRP) conjugated goat anti-rabbit secondary antibody (Santa Cruz Biotechnology) and developed using a chemiluminescent detection reagent obtained from GE Healthcare Life Sciences. Equivalent

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 3

protein loading was verified by stripping the blots and re-probing with a mouse anti-PanActin antibody (NeoMarkers). Cell culture and in vitro treatment with MRK-003 The OVCAR3 and SKOV3 human ovarian cancer cell lines were purchased from ATCC. For MRK-003 dose response experiments, equal numbers of OVCAR3 or SKOV3 cells were plated and serum-starved overnight in growth medium containing 1% FBS. Cells were incubated in triplicate (OVCAR3) or quadruplicate (SKOV3) with either 0 µM, 1 µM, 5 µM, or 10 µM MRK-003. After 48 hours, cells were harvested and quantified. Subsequently, OVCAR3 and SKOV3 cells were treated with either the relevant MRK-003 IC50 or vehicle control only. Cells were harvested six hours after administration of MRK-003 and cell pellets were frozen for immunoblotting and quantitative PCR analyses. Treatment of mice bearing serous ovarian cancer xenografts All xenograft tumors were generated from prospectively consented patients and their clinical response to platinum based adjuvant therapy was used to stratify the cohorts of mice bearing serous OvCa xenografts. Tumors collected from patients who did not develop resurgence of their serous OvCa for longer than 6 months were labeled platinum sensitive. Those tumors derived from patients who developed recurrence less than 6 months were deemed to be platinum resistant. Tumor growth in mice was monitored regularly, and treatment regimens were started when tumor volumes were 200-400 mm3. Mice were then randomly divided into four cohorts of 5 - 7 mice each. Mice bearing xenografts derived from clinically platinum sensitive ovarian cancer were randomized to treatment with either MRK-003 alone (300 mg/ kg in 0.5% methylcellulose) once weekly by oral gavage, paclitaxel and carboplatin (P/C) alone, MRK-003 with P/C, or vehicles of all three drugs. Mice harboring clinically platinum resistant ovarian tumors were treated with either MRK-003 alone, paclitaxel alone, MRK-003 with paclitaxel, or vehicles of MRK-003 and paclitaxel. Paclitaxel (15 mg/kg), carboplatin (50 mg/ kg), and their appropriate vehicles (Cremophor:ethanol and saline, respectively) were given once weekly by intraperitoneal (i.p.) injection. Tumor volumes were determined every three to four days and mice were weighed weekly. The length of experiments was determined by the individual tumor growth patterns in the vehicle setting so that all arms of experiments could be terminated at one time to decrease biologic variability. At the end of each treatment experiment, mice were euthanized and tumors were harvested. One portion of each tumor was snap frozen, and a second portion was fixed in formaldehyde and embedded in paraffin.

Notch inhibition in ovarian cancer

In order to study the acute effect of MRK-003 treatment on Notch pathway activation, mice harboring primary ovarian cancer xenografts were given one dose of MRK-003 or vehicle. Tumors were harvested 6 hours, 24 hours or 48 hours after treatment, and portions were snap frozen as well as fixed in formaldehyde and embedded in paraffin. Quantitative PCR analysis RNA was isolated from frozen xenograft tissue or cell pellets using the GenElute mammalian RNA extraction kit and converted to cDNA (SuperScript VILO,Life Technologies). Quantitative real-time PCR (qPCR) analysis was performed with SsoAdvanced SYBR Green Supermix (Bio-Rad Laboratories) and primers specific for human Hes1 (forward: 5’-ATTCCTCGTCCCCGGTGGCT-3’; reverse: 5’-TCCAGCTTGGAATGCCGCGAG-3’) and β-actin: (forward: 5’- GAGCACAGAGCCTCGCCTTT-3’; reverse: 5’-TCATCATCCATGGTGAGCTGG-3’). For each analyzed sample, relative expression of Hes1 mRNA normalized to β-actin mRNA was determined as previously described.[45] Statistical analysis Because of the non-normal distribution of tumor volumes, non-parametric Wilcoxon rank sum tests were carried out to determine whether the observed differences in tumor volume between the groups in each treatment experiment were statistically significant. All analyses were done using Stata version 11.1 software (StataCorp LP), and a p-value of < 0.05 was considered statistically significant.

Results Expression of Notch1 and Notch3 in serous ovarian cancer Notch 1 and Notch 3 protein expression in both the primary human papillary serous ovarian cancers that were utilized in the current study (OV1 – OV7; see Table 1) and in xenografts derived from these patient samples were assessed by IHC (Figure 1A and 1C). Additionally, Notch1 and Notch3 expression in the same xenografts was analyzed by immunoblotting (Figure 1B and 1D). Variable expression of both Notch1 and Notch3 was found in all primary tumors and xenografts. IHC revealed that Notch protein levels were consistent between each primary tumor and its corresponding xenograft tumor and largely correlated with the protein level detected by immunoblotting.

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 3

Figure 1. Variable expression of Notch1 and Notch3 in ovarian cancer specimens. A and C: Immunohistochemical analysis of Notch1 and Notch3 expression was carried out on xenograft tumors generated from all 7 tumors that were subsequently used for treatment studies (OV1-OV7), as well as on paired primary tissue samples when available (OV1-OV5). Representative images of Notch1 (A) and Notch3 (C) immunostaining are shown. B and D: Western blotting was performed to analyze expression of Notch1 (B) and Notch3 (D) in xenografts derived from primary human serous ovarian cancers (OV1OV7). Uncleaved, inactivated Notch1 and Notch3 as well as cleaved activated Notch1 and Notch3 are shown. An anti-Pan-Actin antibody was used to confirm equivalent loading of samples. The HCC1187 and SKOV3 cell lines were used as a negative control (- Cx) for Notch1 and Notch3, respectively. The MCF-7 cell line was used as a positive control (+ Cx) for both Notch1 and Notch3.

Notch inhibition in ovarian cancer

Patient

Age at diagnosis Stage (years)

Grade Progression free Overall survival Current status survival (months) (months)

OV1 OV2 OV3 OV4 OV5 OV6 OV7

38.3 62.7 60.7 50.8 68.4 54.8 90.5

3 3 3 3 3 ND ND

IV IIIC IIIC IIIC IIIC III Unstaged

34.1 23.9 18.5 22.4 7.9 7.1 4.9

57.9 37.6 24.1 28.9 7.9 10.3 6.5

Alive Deceased Deceased Alive Deceased Deceased Deceased

Table 1. Clinical characteristics of patients whose tumors were analyzed in this study.

Effect of gamma-secretase inhibition on OVCAR3 and SKOV3 cell proliferation and cleaved Notch1 and Hes1 levels OVCAR3 and SKOV3 cells were treated with 1 µM, 5 µM and 10 µM MRK-003. After an incubation period of 48 hours, a dose-dependent reduction in OVCAR3 and SKOV3 cell counts was found compared to cells incubated with medium only (see Figure 2A). Subsequently, OVCAR3 and SKOV3 cells were treated with either MRK-003 at the relevant IC50 (5 µM for OVCAR3, 10 µM for SKOV3) or vehicle control for six hours and then harvested. The impact of MRK-003 on Notch signaling was assessed by immunoblotting analysis of gamma secretasecleaved Notch1 levels and qPCR analysis of target gene Hes1 expression. We observed both a strong reduction in cleaved Notch1 protein levels as well as a marked decrease in Hes1 gene expression relative to the vehicle treated control in both cell lines following treatment with MRK-003 (see Figure 2B-C). Impact of MRK-003 in vivo treatment on Hes1 expression Our in vitro data suggest that MRK-003 specifically targets the Notch pathway in ovarian cancer cell lines. To extend these findings, we assessed the effect of MRK-003 on Notch signaling in PDXs. Ovarian cancer xenografts were harvested from mice 6, 24 or 48 hours after administration of a single dose of MRK-003 or vehicle control and expression of the Notch target gene Hes1 was analyzed by qPCR. In all analyzed xenografts, a 30-70% decrease in Hes1 mRNA levels, relative to levels in vehicle treated controls, was observed after exposure to MRK-003. Figure 3 is a representative example of these analyses and illustrates the relative transcript levels of Hes1 in OV5 xenografts collected six hours after treatment with MRK-003 or vehicle. OV5 was selected as a representative example as this was a platinum resistant tumor that demonstrated a potent synergy with paclitaxel in our in vivo experiments.

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 3

Figure 2. The gamma-secretase inhibitor MRK-003 inhibits OVCAR3 and SKOV3 cell proliferation and decreases NICD1 and Hes1. A: In vitro treatment of OVCAR3 and SKOV3 cells with MRK-003 leads to a dose-dependent reduction of cell proliferation. Cells were incubated with increasing concentrations (010 µM) of MRK-003 for 48 hours in medium containing 1% FBS. OVCAR3 cells were treated in triplicate, and SKOV3 cells were treated in quadruplicate. Average relative changes in cell numbers are shown, and error bars represent the standard error of the mean. B: Western blotting analysis of OVCAR3 and SKOV3 cells incubated with 5 µM (OVCAR3) or 10 µM (SKOV3) MRK-003 for 6 hours reveals a marked decrease in expression of cleaved Notch1 (Val1744). An anti-Pan-Actin antibody was used to confirm equivalent loading of samples. Control = cells incubated with medium only. C: qPCR analysis of Hes1 gene expression in MRK-003 treated OVCAR3 and SKOV3 cells, harvested 6 hours post treatment, showed significantly decreased Hes1 transcript levels compared with cells incubated with medium only. Relative changes in Hes1 mRNA expression are shown, normalized to expression of housekeeping gene β-actin.

Notch inhibition in ovarian cancer

Figure 3. Treatment with MRK-003 decreases Hes1 expression in vivo. qPCR analysis of Hes1 gene expression was performed using xenograft samples collected 6, 24 and 48 hours after treatment with MRK-003 or vehicle. Hes1 expression in OV5 xenografts collected 6 hours after administration of MRK-003 (n=2) or vehicle (n=2) is shown. Average relative changes in Hes1 mRNA expression were determined following normalization to Î˛-actin expression. Error bars represent the standard error of the mean.

Assessment of the impact of MRK-003 as a single agent or in combination with cytotoxic chemotherapeutics on ovarian cancer xenografts The clinical characteristics of the seven patients whose tumors were used to generate primary xenografts are summarized in Table 1. Briefly, all samples were obtained from women with primarily advanced stage disease, three of whom manifested platinum sensitive disease and markedly improved survival compared to the platinum resistant patients. In three independent experiments, mice harboring xenografts derived from a platinum sensitive tumor were randomized to receive either MRK-003 alone, P/C alone, the combination of MRK-003 and P/C, or vehicle alone. We observed a significant reduction in OV3 (p = 0.02) and OV4 (p < 0.01) PDX growth following administration of MRK-003 alone, compared with vehicle treated control tumors (see Figure 4). Treatment with P/C alone significantly decreased tumor volumes of all three analyzed platinum sensitive PDXs, and combination therapy with MRK-003 and P/C was not more effective than treatment with P/C alone (see Figure 4). In panel A, the combined P/C and MRK-003 arm was truncated early so that tumor could be harvested for post treatment investigation. No signs of toxicity were observed in mice receiving MRK-003 and animal weights remained stable during the course of treatment (data not shown).

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Figure 4. MRK-003 treatment in vivo inhibits tumor growth in the majority of analyzed platinum sensitive ovarian cancers. Three independent cohorts of mice bearing xenografts derived from clinically platinum sensitive serous ovarian cancer were treated with vehicle, MRK-003 alone, paclitaxel/ carboplatin (P/C) alone or P/C + MRK-003. A significant anti-tumor effect of treatment with MRK-003 alone was observed in OV3 (center panel) and OV4 (right panel) xenografts (p < 0.05). P/C alone and P/C + MRK-003 were equally effective in significantly reducing tumor growth of OV2 (left panel), OV3 and OV4 xenografts (p < 0.01). Tumor volumes were measured twice weekly. Error bars represent the standard error of the mean.

Chapter 3

Figure 5. MRK-003 and paclitaxel synergize to inhibit growth of platinum resistant ovarian tumors. Three independent cohorts of mice bearing xenografts derived from clinically platinum resistant serous ovarian cancer were randomly divided into four groups. Each group received vehicle, paclitaxel alone, MRK-003 alone or paclitaxel + MRK-003. Significantly heightened inhibition of tumor growth was observed upon combination treatment with paclitaxel + MRK-003, compared with treatment with either drug alone (p < 0.03). Tumors were measured twice weekly. Error bars represent the standard error of the mean. OV5, left panel; OV6, center panel; and OV7, right panel.

Notch inhibition in ovarian cancer

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 3

The three primary human platinum resistant serous ovarian tumors were also established as PDXs in immunocompromised mice. In three separate experiments, mice harboring the tumors were subjected to therapy with either MRK-003 alone, paclitaxel alone, MRK-003 in combination with paclitaxel, or vehicle alone. In all analyzed tumors, enhanced anti-tumor activity was found in mice treated with the combination of MRK-003 and paclitaxel, compared with paclitaxel alone and MRK-003 alone (p < 0.03, see Figure 5). Administration of paclitaxel as a single agent led to a significant decrease of xenograft growth in only one of three tumors (OV7, p < 0.01, see Figure 5, right panel). In addition, MRK-003 monotherapy led to significant tumor growth reduction of OV5 xenografts, compared with vehicle treatment (p = 0.04, see Figure 5, left panel). Again, no significant weight loss or other signs of toxicity were observed in mice treated with MRK-003 (data not shown).

Discussion In the current study, we confirm that members of the Notch signaling pathway are expressed in serous ovarian cancer, and GSI-mediated targeting of this pathway leads to anti-proliferative effects in vitro and anti-tumor activity in vivo. While single agent GSI was tumorstatic in half of the analyzed PDXs, combination therapy with cytotoxic chemotherapy led to significant synergistic anti-tumor effects only in those xenografts originally derived from platinum resistant ovarian cancer patients. Collectively, these pilot data support the role of Notch signaling in ovarian cancer growth particularly in the chemoresistant setting. Various studies have detected Notch1 and Notch3 expression in ovarian tumors by immunohistochemistry (IHC), real time polymerase chain reaction and/or immunoblotting. The results for Notch1 expression via detection by IHC have been variable and difficult to interpret. In one study of relative Notch1 expression in benign ovarian tissue and a spectrum of low to high grade ovarian carcinomas, Notch1 was rarely detected in benign tissue and its expression level correlated with increasing grade and clinical stage of disease. [23] Interestingly, Notch1 was primarily confined to the cell membrane and the cytoplasm. The direct functional or clinical significance of increased cytoplasmic expression in ovarian cancer is unclear given that cleaved Notch1 migrates to the nucleus and is considered the active form. In similar immunohistochemical analyses, no nuclear Notch1 expression was detected suggesting little to no role for Notch1 in ovarian cancer.[46] In contrast, Notch1 nuclear expression was evident in our cohort of samples but was highly variable among and

Notch inhibition in ovarian cancer

within samples. Despite the variation between samples, however, the intensity of nuclear Notch1 expression in each primary tumor and its correlate xenografts was stable reinforcing that Notch1 expression remains consistent across subsequent xenograft generations. These data suggest that protein expression of Notch1 or 3 does not correlate with response to GSI suggesting many other molecular inputs must be involved with modulating response in the platinum resistant setting. While Notch1 IHC studies have generated conflicting results, immunoblotting analyses that have largely focused on Notch 1 NICD expression in primary samples and established human ovarian cancer cell lines are much less controversial. Rose et al. found abundant levels of cleaved Notch1 in the OVCAR3, SKOV3 and CaOV3 cell lines as well as in approximately 75% of the primary ovarian cancer samples analyzed.[22] Consistent with published work [22, 36], we similarly detected cleaved Notch1 in ovarian cancer cell lines and primary ovarian tumor samples by immunoblotting. Thus, in contrast to the collective IHC results, the data to date suggest that cleaved Notch1 is present in some samples thereby providing indirect evidence that Notch1 signaling is active in ovarian cancer. This hypothesis is further bolstered by functional studies that suggest Notch1 promotes ovarian cancer cell proliferation. In one investigation, stable transfection of A2780 ovarian cancer cells with the Notch1 NICD increased both cell proliferation and the rate of colony formation.[26] Others found that down regulation of gamma-secretase activity reduced Notch1 and Hes1 mRNA and protein in the same A2780 ovarian cancer cells and this decrease correlated with a decrease in cell proliferation.[36] Since pan inhibition of gamma-secretase likely inhibits activation of all Notch receptors, the observed effects may not be due to specific disruption of Notch1 signaling. Rose and colleagues provided more direct evidence of Notch1 involvement in cell proliferation by siRNA-mediated reduction of Notch 1 levels.[22] The decrease in Notch1 in response to siRNA correlated with decreased cell proliferation. Thus, the in vitro data suggest that Notch1 signaling can influence the biology of ovarian cancer. Notch3 has also been implicated in the pathology of ovarian cancer as its expression is evident in a significant number of analyzed ovarian cancer samples. Unlike Notch1, however, investigators have focused on nuclear localization of Notch3 as a functional marker of pathway activation.[25, 27, 29, 47] Like Notch1, Notch3 was also expressed at much lower levels in benign ovarian tissue when compared to malignant samples [25, 29], and higher expression levels were associated with either advanced stage [29] or recurrent disease.[28, 48] At the

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 3

genomic level, the Notch3 gene was amplified in a cohort of ovarian cancer samples, as detected by fluorescence in situ hybridization, and this amplification positively correlated with increased Notch3 protein expression.[24] This finding was supported by recent data from The Cancer Genome Atlas (TCGA) which also showed that Notch3 was amplified in serous ovarian carcinoma.[2] Our data support the finding that cleaved Notch3 is present in primary ovarian cancer samples and likely contributes to the pathology of ovarian cancer. [24, 25, 39, 48] Blocking Notch3 signaling by a GSI or a Notch3 specific siRNA reduced cell number and led to an increase in apoptosis in OVCAR3 and A2780 ovarian cancer lines.[24] Interestingly, the Notch ligand Jagged-1 was abundantly expressed in both ovarian cancer cell lines and benign mesothelial cells derived from tumors.[25] Both gene knockdown of Jagged 1 and transfection of the Notch3 intracellular domain (NICD3) suggest the existence of a juxtacrine loop that impacts ovarian cell-cell adhesion and tumor growth.[25] While Notch3 appears to play a role in ovarian cancer cell proliferation, tumor growth and metastasis, additional investigations have implicated Notch signaling in chemoresistance.[28, 39, 48] Knockdown of Notch3 sensitizes OvCar3 cells to carboplatin.[28] Additionally, Notch3 is overexpressed in cisplatin and cisplatin/paclitaxel resistant ovarian cancer cell lines and its inactivation by GSI or siRNA reverses this resistance.[48] More recently, OVCA429 cells that were transduced with a retroviral vector expressing NICD3 showed an increase in expression of smooth muscle actin, Slug and Snail, consistent with an epithelial to mesenchymal transition. Interestingly, this shift was associated with an increase in resistance to carboplatin induced apoptosis.[49] McAuliffe and colleagues suggested that tumorigenic ovarian cancer stem cell (CSC) populations defined as CD44+ cells or the side population fraction (reviewed by [50]) were decreased with inhibition of gamma secretase activity.[39] These data suggest that Notch signaling may support populations of CSCs in ovarian cancer that are resistant to conventional cytotoxic therapies. Notch signaling can modulate other signaling pathways that may influence CSC function. Specifically, the Notch target Hes1 modulates Gli1 expression and Hedgehog signaling providing another mechanism of therapeutic resistance.[51] Inhibition of Hedgehog signaling has been shown to augment the effect of P/C as well as delay recurrence of disease in a PDX model of ovarian cancer.[44] Given that Notch signaling may support CSC activity in ovarian cancer, inhibition of the Notch pathway could selectively target tumor initiating populations and act to restore chemosensitivity. This leads to the hypothesis that Notch pathway inhibition in ovarian cancer would produce the most robust effects in a platinum resistant tumor.

Notch inhibition in ovarian cancer

Our investigation suggests a GSI in combination with conventional cytotoxic chemotherapy significantly improves the anti-tumor effects in primary human ovarian cancer xenografts known to be clinically resistant to platinum therapy. This extends the previous findings by McAuliffe and colleagues who demonstrated the efficacy of targeting the Notch pathway in xenografts derived from established ovarian cancer cell lines.[39] While this elegant study demonstrated GSI induced anti-tumor activity restored chemosensitivity, it was unclear if primary derived ovarian tumors would respond to therapy in vivo in the same fashion. From a clinical perspective, platinum sensitivity, defined as a greater than six month progression free interval after platinum based therapy, is one of the most important prognostic factors for women with ovarian cancer.[52, 53] In order to better understand the in vivo response to GSI, we utilized PDXs derived from women with known platinum sensitive or platinum resistant disease. We observed that single agent MRK-003 significantly inhibited tumor growth of two of three platinum sensitive ovarian tumors, as well as one out of three platinum resistant tumors. When we combined GSI with conventional cytotoxic therapy, synergistic activity occurred only in the clinically defined platinum resistant tumors. These findings support data showing that inhibition of Notch signaling increases sensitivity to chemotherapy [32, 39], implying that the Notch pathway is involved in the development of chemoresistance. Currently, early phase clinical trials assessing treatment efficacy of either single agent GSI or monoclonal antibodies focused on disruption of ligand binding have been conducted in a number of solid tumors including thyroid, non-small cell lung, desmoid and ovarian cancers. [54] The overall promising efficacy of disrupting Notch signaling has been tempered by some adverse events, which are primarily gastrointestinal.[55, 56] In our study, we used the pan GSI MRK-003 whose clinical analog MK-0752 is in development for treatment of several solid malignancies.[56] Although treatment with other GSIs has resulted in toxicity, we did not observe any excessive weight loss or treatment related death in our experiments. The success of targeted therapies inhibiting Notch signaling will also depend upon the development of biomarkers that can identify those patients who are most likely to respond. [54] Currently, there is no universal biomarker that indicates Notch family dependence and is correlated with response to a particular GSI. This objective may become more complicated given recent evidence that Notch signaling can serve an oncogenic or tumor suppressor function depending on the disease context.[57] We observed no correlation between baseline Notch1 or Notch3 protein levels and response to treatment with MRK-003 alone in any of the ovarian tumors we analyzed. A marked decrease in Hes1 mRNA expression was observed

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 3

in both the platinum sensitive and platinum resistant PDXs following GSI therapy (data not shown), confirming that this downstream marker of on target effect is also of limited value for associating anti-tumor effect. Recent work examining the efficacy of MRK-003 in pancreatic cancer xenografts similarly did not identify a clear biomarker.[9] In conclusion, this pilot investigation suggests specific Notch family members are variably expressed in ovarian cancer and that MRK-003-mediated inhibition of Notch signaling reduces ovarian cancer cell proliferation in vitro and inhibits tumor growth in vivo. While single agent anti-tumor activity was observed in many of the PDX analyses, GSI improved conventional cytotoxic therapy exclusively in combination with paclitaxel in those ovarian tumors known to be clinically platinum resistant. Our results support the rationale for further investigation of the pre-clinical and clinical effectiveness of gamma-secretase inhibitors in ovarian cancer, especially in the platinum resistant setting.

Notch inhibition in ovarian cancer

References 1.

Siegel R, Naishadham D, Jemal A. Cancer statistics, 2012. CA Cancer J Clin (2012) 62(1):10-29.

Integrated genomic analyses of ovarian carcinoma. Nature (2011) 474(7353):609-15.

Ozols RF, Bundy BN, Greer BE, Fowler JM, Clarke-Pearson D, Burger RA, et al. Phase III trial of carboplatin and paclitaxel compared with cisplatin and paclitaxel in patients with optimally resected stage III ovarian cancer: a Gynecologic Oncology Group study. J Clin Oncol (2003) 21(17):3194-200.

Armstrong DK, Bundy B, Wenzel L, Huang HQ, Baergen R, Lele S, et al. Intraperitoneal cisplatin and paclitaxel in ovarian cancer. N Engl J Med (2006) 354(1):34-43.

Cooke SL, Brenton JD. Evolution of platinum resistance in high-grade serous ovarian cancer. Lancet Oncol (2011) 12(12):1169-74.

Pinato DJ, Graham J, Gabra H, Sharma R. Evolving concepts in the management of drug resistant ovarian cancer: dose dense chemotherapy and the reversal of clinical platinum resistance. Cancer Treat Rev (2013) 39(2):153-60.

Rizzo P, Osipo C, Foreman K, Golde T, Osborne B, Miele L. Rational targeting of Notch signaling in cancer. Oncogene (2008) 27(38):5124-31.

Chen J, Kesari S, Rooney C, Strack PR, Shen H, Wu L, et al. Inhibition of notch signaling blocks growth of glioblastoma cell lines and tumor neurospheres. Genes Cancer (2010) 1(8):822-35.

Mizuma M, Rasheed ZA, Yabuuchi S, Omura N, Campbell NR, de Wilde RF, et al. The gamma secretase inhibitor MRK-003 attenuates pancreatic cancer growth in preclinical models. Mol Cancer Ther (2012) 11(9):19992009.

10.

Reedijk M. Notch signaling and breast cancer. Adv Exp Med Biol (2012) 727:241-57.

11.

Espinoza I, Miele L. Notch inhibitors for cancer treatment. Pharmacol Ther (2013) 139(2):95-110.

12.

Kopan R, Ilagan MX. The canonical Notch signaling pathway: unfolding the activation mechanism. Cell (2009) 137(2):216-33.

13.

Koch U, Lehal R, Radtke F. Stem cells living with a Notch. Development (2013) 140(4):689-704.

14.

Guruharsha KG, Kankel MW, Artavanis-Tsakonas S. The Notch signalling system: recent insights into the complexity of a conserved pathway. Nat Rev Genet (2012) 13(9):654-66.

15.

Fortini ME. Notch signaling: the core pathway and its posttranslational regulation. Dev Cell (2009) 16(5):63347.

16.

Ranganathan P, Weaver KL, Capobianco AJ. Notch signalling in solid tumours: a little bit of everything but not all the time. Nat Rev Cancer (2011) 11(5):338-51.

17.

Miele L, Golde T, Osborne B. Notch signaling in cancer. Curr Mol Med (2006) 6(8):905-18.

18.

Guilmeau S. Notch signaling and intestinal cancer. Adv Exp Med Biol (2012) 727:272-88.

19.

Hu YY, Zheng MH, Zhang R, Liang YM, Han H. Notch signaling pathway and cancer metastasis. Adv Exp Med Biol (2012) 727:186-98.

20.

Speiser J, Foreman K, Drinka E, Godellas C, Perez C, Salhadar A, et al. Notch-1 and Notch-4 biomarker expression in triple-negative breast cancer. Int J Surg Pathol (2012) 20(2):139-45.

21.

South AP, Cho RJ, Aster JC. The double-edged sword of Notch signaling in cancer. Semin Cell Dev Biol (2012) 23(4):458-64.

22.

Rose SL, Kunnimalaiyaan M, Drenzek J, Seiler N. Notch 1 signaling is active in ovarian cancer. Gynecol Oncol (2010) 117(1):130-3.

23.

Wang M, Wang J, Wang L, Wu L, Xin X. Notch1 expression correlates with tumor differentiation status in ovarian carcinoma. Med Oncol (2010) 27(4):1329-35.

24.

Park JT, Li M, Nakayama K, Mao TL, Davidson B, Zhang Z, et al. Notch3 gene amplification in ovarian cancer. Cancer Res (2006) 66(12):6312-8.

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 3

25.

Choi JH, Park JT, Davidson B, Morin PJ, Shih Ie M, Wang TL. Jagged-1 and Notch3 juxtacrine loop regulates ovarian tumor growth and adhesion. Cancer Res (2008) 68(14):5716-23.

26.

Hopfer O, Zwahlen D, Fey MF, Aebi S. The Notch pathway in ovarian carcinomas and adenomas. Br J Cancer (2005) 93(6):709-18.

27.

Chen X, Thiaville MM, Chen L, Stoeck A, Xuan J, Gao M, et al. Defining NOTCH3 target genes in ovarian cancer. Cancer Res (2012) 72(9):2294-303.

28.

Park JT, Chen X, Trope CG, Davidson B, Shih Ie M, Wang TL. Notch3 overexpression is related to the recurrence of ovarian cancer and confers resistance to carboplatin. Am J Pathol (2010) 177(3):1087-94.

29.

Jung SG, Kwon YD, Song JA, Back MJ, Lee SY, Lee C, et al. Prognostic significance of Notch 3 gene expression in ovarian serous carcinoma. Cancer Sci (2010) 101(9):1977-83.

30.

Oktem G, Sanci M, Bilir A, Yildirim Y, Kececi SD, Ayla S, et al. Cancer stem cell and embryonic developmentassociated molecules contribute to prognostic significance in ovarian cancer. Int J Gynecol Cancer (2012) 22(1):23-9.

31.

Zhang S, Balch C, Chan MW, Lai HC, Matei D, Schilder JM, et al. Identification and characterization of ovarian cancer-initiating cells from primary human tumors. Cancer Res (2008) 68(11):4311-20.

32.

Steg AD, Bevis KS, Katre AA, Ziebarth A, Dobbin ZC, Alvarez RD, et al. Stem cell pathways contribute to clinical chemoresistance in ovarian cancer. Clin Cancer Res (2012) 18(3):869-81.

33.

34.

Lewis HD, Leveridge M, Strack PR, Haldon CD, Oâ&#x20AC;&#x2122;Neil J, Kim H, et al. Apoptosis in T cell acute lymphoblastic leukemia cells after cell cycle arrest induced by pharmacological inhibition of notch signaling. Chem Biol (2007) 14(2):209-19.

35.

Egloff AM, Grandis JR. Molecular pathways: context-dependent approaches to Notch targeting as cancer therapy. Clin Cancer Res (2012) 18(19):5188-95.

36.

Wang M, Wu L, Wang L, Xin X. Down-regulation of Notch1 by gamma-secretase inhibition contributes to cell growth inhibition and apoptosis in ovarian cancer cells A2780. Biochem Biophys Res Commun (2010) 393(1):144-9.

37.

Steg AD, Katre AA, Goodman B, Han HD, Nick AM, Stone RL, et al. Targeting the notch ligand JAGGED1 in both tumor cells and stroma in ovarian cancer. Clin Cancer Res (2011) 17(17):5674-85.

38.

Drenzek JG, Seiler NL, Jaskula-Sztul R, Rausch MM, Rose SL. Xanthohumol decreases Notch1 expression and cell growth by cell cycle arrest and induction of apoptosis in epithelial ovarian cancer cell lines. Gynecol Oncol (2011) 122(2):396-401.

39.

McAuliffe SM, Morgan SL, Wyant GA, Tran LT, Muto KW, Chen YS, et al. Targeting Notch, a key pathway for ovarian cancer stem cells, sensitizes tumors to platinum therapy. Proc Natl Acad Sci U S A (2012) 109(43):E2939-48.

40.

Osanyingbemi-Obidi J, Dobromilskaya I, Illei PB, Hann CL, Rudin CM. Notch signaling contributes to lung cancer clonogenic capacity in vitro but may be circumvented in tumorigenesis in vivo. Mol Cancer Res (2011) 9(12):1746-54.

41.

Ramakrishnan V, Ansell S, Haug J, Grote D, Kimlinger T, Stenson M, et al. MRK003, a gamma-secretase inhibitor exhibits promising in vitro pre-clinical activity in multiple myeloma and non-Hodgkinâ&#x20AC;&#x2122;s lymphoma. Leukemia (2012) 26(2):340-8.

42.

Kondratyev M, Kreso A, Hallett RM, Girgis-Gabardo A, Barcelon ME, Ilieva D, et al. Gamma-secretase inhibitors target tumor-initiating cells in a mouse model of ERBB2 breast cancer. Oncogene (2012) 31(1):93-103.

43.

Konishi J, Kawaguchi KS, Vo H, Haruki N, Gonzalez A, Carbone DP, et al. Gamma-secretase inhibitor prevents Notch3 activation and reduces proliferation in human lung cancers. Cancer Res (2007) 67(17):8051-7.

44.

McCann CK, Growdon WB, Kulkarni-Datar K, Curley MD, Friel AM, Proctor JL, et al. Inhibition of Hedgehog signaling antagonizes serous ovarian cancer growth in a primary xenograft model. PLoS One (2011) 6(11):e28077.

Notch inhibition in ovarian cancer

45.

Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res (2001) 29(9):e45.

46.

Kluk MJ, Ashworth T, Wang H, Knoechel B, Mason EF, Morgan EA, et al. Gauging NOTCH1 Activation in Cancer Using Immunohistochemistry. PLoS One (2013) 8(6):e67306.

47.

Park JT, Shih Ie M, Wang TL. Identification of Pbx1, a potential oncogene, as a Notch3 target gene in ovarian cancer. Cancer Res (2008) 68(21):8852-60.

48.

49.

Gupta N, Xu Z, El-Sehemy A, Steed H, Fu Y. Notch3 induces epithelial-mesenchymal transition and attenuates carboplatin-induced apoptosis in ovarian cancer cells. Gynecol Oncol (2013) 130(1):200-6.

50.

Foster R, Buckanovich RJ, Rueda BR. Ovarian cancer stem cells: Working towards the root of stemness. Cancer Lett (2013) 338(1):147-57.

51.

Schreck KC, Taylor P, Marchionni L, Gopalakrishnan V, Bar EE, Gaiano N, et al. The Notch target Hes1 directly modulates Gli1 expression and Hedgehog signaling: a potential mechanism of therapeutic resistance. Clin Cancer Res (2010) 16(24):6060-70.

52.

Markman M, Reichman B, Hakes T, Jones W, Lewis JL, Jr., Rubin S, et al. Responses to second-line cisplatinbased intraperitoneal therapy in ovarian cancer: influence of a prior response to intravenous cisplatin. J Clin Oncol (1991) 9(10):1801-5.

53.

Markman M, Rothman R, Hakes T, Reichman B, Hoskins W, Rubin S, et al. Second-line platinum therapy in patients with ovarian cancer previously treated with cisplatin. J Clin Oncol (1991) 9(3):389-93.

54.

Takebe N, Nguyen D, Yang SX. Targeting Notch signaling pathway in cancer: Clinical development advances and challenges. Pharmacol Ther (2013).

55.

Fouladi M, Stewart CF, Olson J, Wagner LM, Onar-Thomas A, Kocak M, et al. Phase I trial of MK-0752 in children with refractory CNS malignancies: a pediatric brain tumor consortium study. J Clin Oncol (2011) 29(26):3529-34.

56.

Krop I, Demuth T, Guthrie T, Wen PY, Mason WP, Chinnaiyan P, et al. Phase I pharmacologic and pharmacodynamic study of the gamma secretase (Notch) inhibitor MK-0752 in adult patients with advanced solid tumors. J Clin Oncol (2012) 30(19):2307-13.

57.

Avila JL, Kissil JL. Notch signaling in pancreatic cancer: oncogene or tumor suppressor? Trends Mol Med (2013) 19(5):320-7.

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter

The effects of Notch inhibition and platinum-based chemotherapy on ovarian cancer stem cell markers

Jolijn W. Groeneweg1,2, Ling Zhang1, Sarah Chisholm1, Whitfield B. Growdon1,2,3, Bo R. Rueda1,2,3, Rosemary Foster1,2,3

Vincent Center for Reproductive Biology, Department of Obstetrics and Gynecology, Massachusetts General Hospital, Boston, MA, United States

Harvard Medical School, Boston, MA, United States

Division of Gynecologic Oncology, Department of Obstetrics and Gynecology, Massachusetts General Hospital, Boston, MA, United States

Manuscript in preparation

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 4

Abstract Objective: The therapeutic management of ovarian cancer is seldom curative due to the frequent development of chemoresistant recurrent disease. Cancer stem cells (CSCs) are thought to be involved in resistance to chemotherapy and disease relapse in ovarian cancer. The development of therapeutic strategies that target ovarian CSCs has been a recent focus of investigation. Inhibition of the Notch pathway, a signaling cascade implicated in stem cell function, has shown preclinical benefit in ovarian cancer. In the current study, we sought to determine the effects of treatment with a gamma-secretase inhibitor (GSI) and standard chemotherapy on CSC levels in primary human ovarian cancer xenografts. Methods: Mice bearing patient derived serous ovarian cancer xenografts were treated with vehicle, GSI (MRK-003), or paclitaxel and carboplatin (P/C). Treated tumor samples were used to analyze CD133+ and CD44+ populations by flow cytometry as well as expression levels of CD133, CD44 and the stemness genes Nanog, Sox2 and Oct4 by qPCR. Results: Treatment with GSI or P/C led to significant inhibition of tumor growth in both analyzed ovarian cancer xenograft cohorts. Relative to vehicle controls, GSI treatment did not affect CD133+ or CD44+ cell frequency or transcript levels of CD133 or CD44 CSC markers and transcript of the analyzed stemness genes. Increased numbers of CD133+ and CD44+ cells as well as elevated expression of CD133, CD44, Nanog and Sox2 mRNA were observed in tumors treated with P/C. Conclusion: While enrichment of CSC populations was seen in patient derived ovarian cancer xenografts treated with paclitaxel and carboplatin, no effects of GSI therapy on the relative CSC content of the analyzed tumors were observed. Additional research is warranted to further evaluate the effects of Notch inhibition on CSC activity in ovarian cancer.

Effects of Notch inhibition and chemotherapy on ovarian CSCs

Introduction Ovarian cancer represents the second most common and most lethal gynecologic malignancy in the United States. In 2014, 21,980 new cases and 14,270 disease related deaths are estimated to occur.[1] Due to a lack of reliable screening tests and the non-specific symptoms of ovarian cancer, approximately 75% of patients present with metastatic, advanced stage disease.[2, 3] Standard initial treatment consists of surgical staging with tumor debulking followed by platinum and taxane based chemotherapy.[3] Although this therapeutic approach leads to a complete remission in the majority of patients, recurrence and the development of chemoresistant disease are common, incurable events.[4] In order to prolong survival of patients with recurrent ovarian cancer, identification of the biological mechanisms behind chemoresistance and tumor relapse is of pivotal importance. Therapeutic targeting of molecular aberrations that render cells resistant to cytotoxic agents may be key to improving the prognosis of patients with ovarian cancer. Recent investigations have suggested the existence of a small subpopulation of cancer cells harboring tumorigenic capacity and the potential to survive chemotherapeutic agents.[5, 6] These cells, named cancer stem cells (CSCs) or tumor-initiating cells, were shown to possess characteristics similar to benign stem cells, such as the ability of self-renewal and asymmetric cell division.[5, 7] In addition, normal stem cells and CSCs share an increased resistance to cytotoxic therapy due to their quiescent nature and expression of ATP-binding cassette (ABC) transporters capable of active efflux of these agents.[8] In numerous solid and hematologic malignancies, tumor cells with CSC properties have been isolated based on expression of distinctive markers or their ability to efflux Hoechst dye with formation of a side population. [9-16] Recent studies have isolated and characterized CSCs from human ovarian cancer cell lines, ovarian tumors and ascites.[14, 17-26] Ovarian CSCs have been identified as a side population [17, 23], populations expressing CD133 [18, 19, 26], CD44 [14, 20], CD117 [14, 24] or CD24 [22], and populations with ALDH1 enzymatic activity [21, 25, 26]. Characterization of the isolated CSCs revealed properties such as tumor initiation, chemoresistance and in vitro sphere formation, confirming their stem-like behavior. In addition, elevated expression of stem cell associated genes was observed in ovarian CSCs, compared with tumor bulk cells.[14, 22, 23, 27] Members of the Notch signaling pathway were among the stem cell associated genes found to be upregulated in ovarian CSCs.[14, 27]

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 4

The Notch signaling pathway is well known for its role during embryonic development and its involvement in many cellular processes including proliferation, differentiation and apoptosis. [28, 29] Recently, multiple studies have demonstrated Notch pathway activity in cancer and Notch signaling has been implicated in CSC activity.[30-32] Activation of this signaling cascade occurs through binding of a Notch ligand to one of its receptors (Notch 1-4) on a neighboring cell. Cleavage of the Notch receptor then leads to the formation of an active intracellular domain (NICD) that translocates to the nucleus and activates transcription of target genes.[28] Gamma-secretase, responsible for the final cleavage of Notch and release of the NICD, represents the most important target for developmental therapeutics inhibiting the Notch pathway.[33, 34] In ovarian cancer, expression of Notch1 and Notch3 on a genetic and protein level has been described.[35-40] Moreover, Notch pathway alterations were recently identified among the most common genetic aberrations in ovarian cancer.[39] Overexpression of genes involved in Notch signaling was found in ovarian side population cells, and increased Notch1 mRNA expression has been described in ovarian spheroid cells in culture.[14, 27] These data suggest a role for Notch signaling in ovarian CSCs. Recent preclinical studies have demonstrated therapeutic efficacy of targeting the Notch pathway in a variety of solid tumors.[32, 41-44] In ovarian cancer, treatment with a gamma-secretase inhibitor (GSI) led to reduced proliferation of ovarian cancer cell lines and growth inhibition of xenografts derived from cell lines and primary ovarian tumors.[45, 46] In addition, our group has recently demonstrated synergistic anti-tumor activity of the GSI MRK-003 in combination with paclitaxel in platinum resistant patient derived ovarian cancer xenografts.[46] Several studies have shown increased expression of CSC markers or enrichment of SP cells following treatment with chemotherapy in primary human ovarian tumors and ascites as well as ovarian cancer cell lines, while one investigation found no change in CSC markers after cytotoxic therapy in ovarian cancer cell line derived xenografts.[45, 47-50] A recent publication has demonstrated that GSI treatment depletes CSCs in ovarian cancer cell lines and cell line derived xenografts.[45] In the current study, we therefore aimed to evaluate the effects of Notch inhibition and standard chemotherapy on CSC content in primary human serous ovarian cancer xenografts by assessing expression levels of CSC markers and genes involved in stem cell function following treatment with GSI or paclitaxel and carboplatin.

Effects of Notch inhibition and chemotherapy on ovarian CSCs

Methods Generation and propagation of primary human serous ovarian cancer xenografts Mouse xenografts derived from primary human high-grade papillary serous ovarian cancer were established and subsequently transplanted, as previously described. [51] With informed consent and adhering to an institutional review board approved protocol, primary human serous ovarian carcinoma samples were obtained and processed using enzymatic digestion. Removal of endothelial (CD31+) and hematopoietic (CD45+) cells was performed by magnetic depletion. The remaining ovarian cancer cells, suspended in PBS with Matrigel (1:1), were injected subcutaneously (s.c.) into 6- 8 week old female NOD/SCID mice. Mice were monitored regularly for tumor formation, and euthanized by CO2 inhalation when xenografts had reached a size of 1 - 2 cm. Excised tumors were then enzymatically processed and magnetic depletion of H-2Kd positive mouse cells was carried out, followed by re-injection of the obtained cells in PBS/Matrigel (1:1) s.c. into NOD/SCID mice. By serially transplanting these ovarian tumors, while maintaining their serous histology, cohorts of mice harboring xenografts derived from the same primary tumor were generated and subsequently used for the described treatment studies. All mouse experiments were performed in accordance with protocols approved by the Institutional Animal Care and Use Committee. Drugs The gamma-secretase inhibitor MRK-003 was provided by Merck Laboratories. Paclitaxel was purchased from Sigma-Aldrich, and carboplatin was obtained from the institutionâ&#x20AC;&#x2122;s clinical pharmacy. Treatment of mice bearing serous ovarian cancer xenografts Two cohorts of mice bearing ovarian cancer xenografts measuring 200 - 500 mm3 were randomly divided into three groups of 5 - 15 mice each, receiving either MRK-003, paclitaxel and carboplatin (P/C), or vehicle. All drugs were administered once weekly, MRK-003 (300 mg/ kg) by oral gavage and P/C (15 mg/kg and 50 mg/kg, respectively) by intraperitoneal injection. Mice in the vehicle arm received the vehicle of all three agents: 0.5% methylcellulose by oral gavage (MRK-003 vehicle) and cremophor:ethanol (1:1, paclitaxel vehicle) and saline (carboplatin vehicle) by intraperitoneal injection. Tumors were measured every 3-4 days with calipers, and mouse weights were evaluated weekly. Tumor volumes in mm3 were calculated using the formula [length in mm x width in mm x width in mm] / 2. Treatment periods were 12 and 17 days. At the end of each experiment, mice were euthanized and tumors were

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 4

harvested. A portion of each tumor was used for flow cytometry and another portion was snap frozen for RNA analysis. In order to study the acute effects of MRK-003 and P/C treatment on expression of CSC markers, mice harboring OT1 xenografts were given a single dose of P/C, MRK-003, or their vehicles. Each treatment arm comprised two mice. The ones receiving P/C were euthanized 72 hours after treatment, while those receiving MRK-003 were euthanized 24 hours after treatment. The excised tumors were utilized for flow cytometric analyses. Flow cytometry Ovarian cancer xenografts were dissociated as described above and the obtained cells were resuspended in PBS buffer (PBS with 2% FBS and 1 mM EDTA). Cells were incubated with human FcR blocking reagent (Miltenyi Biotec) followed by incubation with the relevant fluorescently labeled antibodies: FITC conjugated anti-mouse H-2Kd (BD Biosciences) to eliminate H-2Kd positive mouse cells and PE conjugated anti-human CD133 (Miltenyi Biotec), PE conjugated anti-human CD24 (BD Biosciences), PerCP-Cy™5.5 conjugated anti-human CD117 (BD Biosciences), or APC conjugated anti-human CD44 (Miltenyi Biotec). Cells were washed in PBS buffer then incubated with Live/dead cell viability dye (Invitrogen). They were subsequently fixed in 4% paraformaldehyde and washed in PBS buffer. Flow cytometry was performed on a BD LSRII analyzer with BD FACSDiva software (BD Biosciences). The obtained data were analyzed using FlowJo 7.6.5 software (Treestar, Inc.). Quantitative PCR analysis Snap frozen tumor tissue of xenografts harvested post treatment with vehicle, P/C or GSI was used for quantitative real-time PCR (qPCR) analyses. RNA of 4- 5 xenografts per treatment arm per cohort was extracted using a GenElute mammalian RNA extraction kit (Sigma-Aldrich), according to the manufacturer’s instructions. A SuperScript VILO kit (Life Technologies) was used to synthesize cDNA, using 500 ng of isolated RNA for every 20 µl cDNA. Primers for human CD133, CD44, Nanog, Sox2, Oct4 and housekeeping gene β-actin were designed with Primer-BLAST (NCBI) and obtained from Invitrogen. The utilized primer sequences are listed in Supplementary Table 1. Quantitative real-time PCR analysis was performed using SsoAdvanced SYBR Green Supermix (Bio-Rad Laboratories), on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories). Relative mRNA expression of all genes was determined as previously described.[52]

Effects of Notch inhibition and chemotherapy on ovarian CSCs

Statistical analysis Non-parametric Wilcoxon rank sum tests were used to assess statistical significance of the observed differences in tumor growth after P/C or GSI therapy in vivo. One-way analysis of variance (ANOVA) was performed to test for statistical significance of the different expression levels post treatment as analyzed by flow cytometry and qPCR. Stata (version 11.1, StataCorp, LP) and GraphPad Prism (version 6, GraphPad software, Inc.) software were utilized. A p-value of < 0.05 was considered statistically significant.

Results Effects of treatment with GSI or standard chemotherapy on ovarian cancer xenograft growth Cohorts of mice bearing tumors derived from two individual human ovarian cancers (OT1 and OT2) were treated with vehicle, P/C, or GSI. As shown in Figure 1, GSI treatment led to significantly reduced tumor growth compared to vehicle treated controls (p < 0.01) in both experiments. In addition, P/C therapy significantly impeded tumor growth in both cohorts (p < 0.003).

Figure 1. Treatment with P/C or GSI significantly reduced tumor growth of OT1 and OT2 xenografts. Mice bearing xenografts derived from OT1 (A) or OT2 (B) primary serous ovarian tumors were treated with either vehicle, the GSI MRK-003, or P/C. Tumors were measured twice weekly, and the percent change in tumor volume compared with baseline volume (100%) is shown. Error bars represent the standard error of the mean (S.E.M.). * p < 0.01.

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 4

Effects of treatment with GSI or P/C on CSC populations OT1 and OT2 tumors collected after chronic treatment with vehicle, GSI or P/C were utilized to study the effects of these agents on CSC populations. The harvested xenografts were dissociated and the obtained cells of each treatment arm were pooled, stained and subjected to flow cytometry. Small CD133 positive fractions were observed in OT1 and OT2 vehicle control samples (2.9% and 1.4%, respectively), while 14.1% of OT1 and 1.3% of OT2 vehicle control cells expressed CD44. No CD117 positive cells were detected in the analyzed tumor samples (< 0.05%). In contrast, CD24 expression was found in 93.7% of OT1 and in 92.6% of OT2 control populations (Figure 2). We therefore focused on CD133+ and CD44+ cell frequency in the described post treatment analyses. Treatment with GSI did not significantly alter the levels of cells expressing CD133 or CD44. P/C therapy induced a significant increase in the CD133 positive populations of OT1 and OT2 xenografts, as compared to vehicle controls (p = 0.01). The fraction expressing CD44 was 1.5-fold higher in OT1 and 3.2-fold higher in OT2 xenografts after treatment with P/C, although this increase lacked statistical significance (Figure 3A).

Figure 2. Fractions of CD133, CD44, CD24 and CD117 expressing cells in the vehicle control samples of the two primary ovarian cancer xenograft cohorts utilized in the current study, analyzed by flow cytometry. The percentage of positive cells is shown for each CSC marker. A) OT1, B) OT2.

Effects of Notch inhibition and chemotherapy on ovarian CSCs

In addition to the flow cytometric analyses of OT1 and OT2 tumors after chronic treatment with GSI or P/C, OT1 xenografts were used to study the acute effects of these therapies on the fractions of CD133 and CD44 expressing cells. In OT1 tumors harvested 24 hours after a single dose of GSI, no effect of this agent on CD133 or CD44 levels was seen. Compared with vehicle treated controls, tumors harvested 72 hours after P/C treatment showed a 3-fold and a 2-fold increase in CD133 and CD44 positive fractions, respectively (Figure 3B).

Figure 3. Increased levels of CD133 positive and CD44 positive cells in OT1 and OT2 xenografts were found after P/C treatment, while GSI therapy induced no changes in CD133 and CD44 fractions. A) Average effects of P/C and GSI on the percentages of CD133 (left) and CD44 (right) positive cells in OT1 and OT2 xenografts, compared with vehicle controls. At the completion of the in vivo treatment period, tumors of each treatment arm were pooled and analyzed for expression of CD133 and CD44 by flow cytometry. Error bars represent the S.E.M., * p = 0.01. B) Flow cytometry analysis of OT1 xenografts collected after acute treatment with GSI (24 hours) or P/C (72 hours). The fold change in CD133 positive (left) and CD44 positive (right) tumor fractions is shown, compared with vehicle treated tumors.

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 4

Effects of treatment with GSI or P/C on CD133 and CD44 mRNA expression To further evaluate the effects of GSI and chemotherapy on the tumor cell populations expressing CD133 or CD44, mRNA levels of both CSC markers were analyzed in OT1 and OT2 xenografts using qPCR. Significantly elevated mRNA expression of both CD133 and CD44 was observed in samples treated with P/C, as compared to vehicle treated xenograft samples (p < 0.0001). No change in CD133 and CD44 mRNA expression was observed in GSI treated tumors (Figure 4).

Figure 4. Increased CD133 and CD44 mRNA levels were observed in OT1 and OT2 xenografts following P/C treatment, while GSI therapy induced no changes in CD133 and CD44 transcript levels. The average fold change in CD133 (left) and CD44 (right) mRNA expression levels of OT1 and OT2 xenografts after treatment with GSI or P/C is shown, compared with vehicle treated tumors. Xenografts were collected at the end of the in vivo treatment periods, and of each xenograft cohort 4-5 tumors per treatment arm were analyzed for mRNA expression of CD133 and CD44 by qPCR. Error bars represent the S.E.M., * p < 0.0001.

Effects of treatment with GSI or P/C on the expression of stem cell genes RNA extracted from OT1 and OT2 samples was used to evaluate the expression of Nanog, Sox2 and Oct4 mRNA following therapy with P/C or GSI. Significantly elevated transcript levels of Sox2 and Nanog were observed in OT1 and OT2 xenografts post chemotherapy, compared with vehicle controls (p = 0.001 and p = 0.03, respectively). No change in Oct4 mRNA expression was seen in samples treated with P/C. Treatment with GSI did not alter the levels of Nanog, Sox2 or Oct4 transcripts in OT1 and OT2 tumors (Figure 5).

Effects of Notch inhibition and chemotherapy on ovarian CSCs

Figure 5. P/C treatment led to elevated Nanog and Sox2 mRNA levels in OT1 and OT2 xenografts, while GSI therapy induced no changes in Nanog, Oct4 and Sox2 transcript levels. The average fold change in Nanog (upper left), Oct4 (upper right) and Sox2 (lower) mRNA expression levels of OT1 and OT2 xenografts after treatment with GSI or P/C is shown, compared with vehicle treated tumors. Xenografts were collected at the end of the in vivo treatment periods, and of each xenograft cohort 4-5 tumors per treatment arm were analyzed for mRNA expression of Nanog, Oct4 and Sox2 by qPCR. Error bars represent the S.E.M., * p < 0.03.

Discussion In the present study, we have shown that CD133 and CD44 are expressed in small subsets of cells derived from the two analyzed primary serous ovarian cancer xenograft models. In addition, CD24 positive fractions form the majority of these tumors and no expression of CD117 was detected. Inhibition of the Notch pathway with a GSI did not affect the relative presence of CD133+ or CD44+ cells or CD133 and CD44 gene expression in the analyzed xenografts as assessed by flow cytometry and qPCR. Also, mRNA levels of the stem cell related genes Nanog, Sox2 and Oct4 were unaltered following GSI treatment. Standard chemotherapy (P/C) augmented the proportions of CD133 and CD44 expressing cells in both xenograft models, and qPCR analyses showed a significant increase in CD133, CD44, Nanog

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 4

and Sox2 transcript levels after P/C treatment. Collectively, these results provide evidence to suggest that while chemotherapy elevates the proportion of cells with stem-like properties in serous ovarian cancer, GSI does not affect the stem-like properties of the analyzed ovarian tumors. Multiple studies have focused on the detection and isolation of ovarian CSCs. The different methods that have been utilized include selection of tumor cells based on expression of cell surface markers, enzymatic activity of ALDH1 or identification of a side population.[53] Human ovarian cancer cells that express CD133, CD44, CD117 or CD24 have been shown to possess CSC properties like chemoresistance, initiation of tumor growth and asymmetric cell division. Our laboratory has previously reported various levels of CD133, CD44 and CD24 expressing cells in primary human serous ovarian cancer xenografts, while no expression of CD117 was observed.[51] The current study confirms these findings, although the CD24 positive fraction in both analyzed tumors was considerably higher (>90%) than the previously reported median expression level of this cell surface protein (55%). Consistent with recent investigations demonstrating the in vitro and in vivo efficacy of GSIs in ovarian cancer, treatment of mice bearing OT1 or OT2 ovarian cancer xenografts with the GSI MRK-003 led to significant inhibition of tumor growth.[45, 46] In addition to the effectiveness of GSI as monotherapy in ovarian cancer, previous research has shown augmented tumor growth inhibition following dual treatment with GSI and standard chemotherapy as compared to each treatment alone.[45, 46] This synergistic effect suggests that inhibition of the Notch pathway effectively targets chemoresistant subpopulations of ovarian tumors that may include the tumor-initiating (CSC) fractions. However, despite the significant anti-tumor activity of GSI in OT1 and OT2 xenografts, no effect of Notch inhibition on the expression of CD133, CD44 and stemness genes was observed. Our findings are in contrast with recent studies that showed GSI therapy helps eliminate CSCs in several solid tumors.[41, 42, 45, 54-56] McAuliffe et al. demonstrated that in vitro treatment with a GSI reduced the side population in ovarian cancer cell lines and in vivo GSI therapy decreased the side population as well as CD44 and ALDH1 mRNA levels in cell line derived xenografts.[45] While one could argue that the flow cytometric analyses by McAuliffe et al. may have identified a different tumor cell population to represent the CSC fraction by analyzing the side population as compared to CD133 positive and CD44 positive cells in our study, both investigations analyzed CD44 mRNA expression and obtained clearly distinct results. The observed lack of effect of Notch inhibition on CSCs, contrasting the previously reported decrease in ovarian CSC content after GSI treatment [45],

Effects of Notch inhibition and chemotherapy on ovarian CSCs

may be explained in part by the heterogeneity of the primary human xenografts utilized in the current study. Established ovarian cancer cell lines and xenografts derived from these cell lines consitute relatively homogenous cell populations, whereas patient derived xenografts represent the heterogeneous primary tumor comprising subpopulations of cells with distinct properties and functions. Multiple CSC marker profiles that identify CSC populations have been described in ovarian cancer.[53] The variety of identification strategies and heterogeneity of the disease indicate that none of the single markers solely distinguishes the ovarian CSC fraction from the non-CSC fraction, and several cell populations with distinct marker profiles may represent the ovarian CSCs. Further research on ovarian CSC fractions and the effect of Notch inhibition is therefore needed, using patient derived xenografts or clinical samples. Alternative explanations for the unaltered CSC fractions post GSI in the analyzed xenografts may include crosstalk of Notch signaling with other signaling pathways such as the Wnt and Hedgehog cascades. This potential crosstalk could influence CSC function and signals through these other pathways may alter the response of CSCs to Notch targeting therapeutics. Yet another mechanism could be the potential of GSI to not only target the CSC populations, but also the non-CSC tumor fractions thereby reducing ovarian tumor growth without altering the proportion of CSCs. Yet, these mechanisms remain purely speculative and studies in other solid tumors have suggested that GSI therapy is effective at eliminating CSCs in patient derived xenografts.[41, 54] In line with previous studies, expansion of CD44+ and CD133+ cells as well as elevated transcript levels of genes involved in stemness were observed following treatment with standard chemotherapy.[45, 47-49] This enrichment of cells with CSC properties confirms the hypothesis that although conventional cytotoxic therapy effectively targets the differentiated cells comprising the bulk of ovarian tumors, it fails to eliminate the CSC population. These findings underscore the relevance of novel treatment strategies combining standard chemotherapy with a targeting therapeutic to reduce both tumor bulk and the tumorinitiating cell populations. Although our study found no effect of Notch inhibition on the tumor fractions expressing the described CSC markers or stemness genes, the previously reported synergistic anti-tumor activity of treatment with GSI and standard chemotherapy suggests that GSI in fact does target a cell population that would otherwise surivive chemotherapy. [45, 46] The current investigation is limited by the small sample size, the few CSC markers used and the lack of functional studies to assess CSC activity. Further research is therefore warranted to determine the effect of Notch inhibition on CSCs in ovarian cancer.

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 4

In conclusion, the present study suggests that standard paclitaxel and carboplatin treatment induces enrichment of tumor-initiating fractions in ovarian cancer, highlighting the need for novel therapeutic strategies to selectively target ovarian CSC populations. While inhibitors of Notch signaling have been proposed as such a targeted therapy, the current investigation failed to demonstrate an effect of GSI therapy on the ovarian CSC content. Further research is needed to determine whether inhibition of the Notch pathway affects CSC populations.

Effects of Notch inhibition and chemotherapy on ovarian CSCs

References 1.

Siegel R, Ma J, Zou Z, Jemal A. Cancer statistics, 2014. CA Cancer J Clin. 2014 Jan;64(1):9-29.

Cannistra SA. Cancer of the ovary. N Engl J Med. 2004 Dec 9;351(24):2519-2.

Hennessy BT, Coleman RL, Markman M. Ovarian cancer. Lancet. 2009 Oct 17;374(9698):1371-82.

Foley OW, Rauh-Hain JA, del Carmen MG. Recurrent epithelial ovarian cancer: An update on treatment. Oncology (Williston Park). 2013 Apr;27(4):288,94, 298.

Jordan CT, Guzman ML, Noble M. Cancer stem cells. N Engl J Med. 2006 Sep 21;355(12):1253-61.

Dalerba P, Cho RW, Clarke MF. Cancer stem cells: Models and concepts. Annu Rev Med. 2007;58:267-84.

Wicha MS, Liu S, Dontu G. Cancer stem cells: An old idea--a paradigm shift. Cancer Res. 2006 Feb 15;66(4):1883,90; discussion 1895-6.

Dean M, Fojo T, Bates S. Tumour stem cells and drug resistance. Nat Rev Cancer. 2005 Apr;5(4):275-84.

Goodell MA, Brose K, Paradis G, Conner AS, Mulligan RC. Isolation and functional properties of murine hematopoietic stem cells that are replicating in vivo. J Exp Med. 1996 Apr 1;183(4):1797-806.

10.

Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ, Clarke MF. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A. 2003 Apr 1;100(7):3983-8.

11.

Singh SK, Hawkins C, Clarke ID, Squire JA, Bayani J, Hide T, et al. Identification of human brain tumour initiating cells. Nature. 2004 Nov 18;432(7015):396-401.

12.

Collins AT, Berry PA, Hyde C, Stower MJ, Maitland NJ. Prospective identification of tumorigenic prostate cancer stem cells. Cancer Res. 2005 Dec 1;65(23):10946-51.

13.

Li C, Heidt DG, Dalerba P, Burant CF, Zhang L, Adsay V, et al. Identification of pancreatic cancer stem cells. Cancer Res. 2007 Feb 1;67(3):1030-7.

14.

15.

Sullivan JP, Minna JD, Shay JW. Evidence for self-renewing lung cancer stem cells and their implications in tumor initiation, progression, and targeted therapy. Cancer Metastasis Rev. 2010 Mar;29(1):61-72.

16.

Friel AM, Zhang L, Curley MD, Therrien VA, Sergent PA, Belden SE, et al. Epigenetic regulation of CD133 and tumorigenicity of CD133 positive and negative endometrial cancer cells. Reprod Biol Endocrinol. 2010 Dec 1;8:147,7827-8-147.

17.

Moserle L, Indraccolo S, Ghisi M, Frasson C, Fortunato E, Canevari S, et al. The side population of ovarian cancer cells is a primary target of IFN-alpha antitumor effects. Cancer Res. 2008 Jul 15;68(14):5658-6.

18.

Baba T, Convery PA, Matsumura N, Whitaker RS, Kondoh E, Perry T, et al. Epigenetic regulation of CD133 and tumorigenicity of CD133+ ovarian cancer cells. Oncogene. 2009 Jan 15;28(2):209-18.

19.

Curley MD, Therrien VA, Cummings CL, Sergent PA, Koulouris CR, Friel AM, et al. CD133 expression defines a tumor initiating cell population in primary human ovarian cancer. Stem Cells. 2009 Dec;27(12):2875-83.

20.

Alvero AB, Chen R, Fu HH, Montagna M, Schwartz PE, Rutherford T, et al. Molecular phenotyping of human ovarian cancer stem cells unravels the mechanisms for repair and chemoresistance. Cell Cycle. 2009 Jan 1;8(1):158-66.

21.

Landen CN,Jr, Goodman B, Katre AA, Steg AD, Nick AM, Stone RL, et al. Targeting aldehyde dehydrogenase cancer stem cells in ovarian cancer. Mol Cancer Ther. 2010 Dec;9(12):3186-99.

22.

Gao MQ, Choi YP, Kang S, Youn JH, Cho NH. CD24+ cells from hierarchically organized ovarian cancer are enriched in cancer stem cells. Oncogene. 2010 May 6;29(18):2672-80.

23.

Hu L, McArthur C, Jaffe RB. Ovarian cancer stem-like side-population cells are tumourigenic and chemoresistant. Br J Cancer. 2010 Apr 13;102(8):1276-83.

24.

Luo L, Zeng J, Liang B, Zhao Z, Sun L, Cao D, et al. Ovarian cancer cells with the CD117 phenotype are highly tumorigenic and are related to chemotherapy outcome. Exp Mol Pathol. 2011 Oct;91(2):596-602.

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 4

25.

Silva IA, Bai S, McLean K, Yang K, Griffith K, Thomas D, et al. Aldehyde dehydrogenase in combination with CD133 defines angiogenic ovarian cancer stem cells that portend poor patient survival. Cancer Res. 2011 Jun 1;71(11):3991-400.

26.

Kryczek I, Liu S, Roh M, Vatan L, Szeliga W, Wei S, et al. Expression of aldehyde dehydrogenase and CD133 defines ovarian cancer stem cells. Int J Cancer. 2012 Jan 1;130(1):29-3.

27.

28.

Kopan R, Ilagan MX. The canonical notch signaling pathway: Unfolding the activation mechanism. Cell. 2009 Apr 17;137(2):216-33.

29.

Fortini ME. Notch signaling: The core pathway and its posttranslational regulation. Dev Cell. 2009 May;16(5):633-47.

30.

Miele L, Golde T, Osborne B. Notch signaling in cancer. Curr Mol Med. 2006 Dec;6(8):905-18.

31.

Ranganathan P, Weaver KL, Capobianco AJ. Notch signalling in solid tumours: A little bit of everything but not all the time. Nat Rev Cancer. 2011 May;11(5):338-51.

32.

Takebe N, Nguyen D, Yang SX. Targeting notch signaling pathway in cancer: Clinical development advances and challenges. Pharmacol Ther. 2014 Feb;141(2):140-9.

33.

Rizzo P, Osipo C, Foreman K, Golde T, Osborne B, Miele L. Rational targeting of notch signaling in cancer. Oncogene. 2008 Sep 1;27(38):5124-31.

34.

Egloff AM, Grandis JR. Molecular pathways: Context-dependent approaches to notch targeting as cancer therapy. Clin Cancer Res. 2012 Jul 6.

35.

Hopfer O, Zwahlen D, Fey MF, Aebi S. The notch pathway in ovarian carcinomas and adenomas. Br J Cancer. 2005 Sep 19;93(6):709-18.

36.

Park JT, Li M, Nakayama K, Mao TL, Davidson B, Zhang Z, et al. Notch3 gene amplification in ovarian cancer. Cancer Res. 2006 Jun 15;66(12):6312-8.

37.

Rose SL, Kunnimalaiyaan M, Drenzek J, Seiler N. Notch 1 signaling is active in ovarian cancer. Gynecol Oncol. 2010 Apr;117(1):130-3.

38.

Wang M, Wang J, Wang L, Wu L, Xin X. Notch1 expression correlates with tumor differentiation status in ovarian carcinoma. Med Oncol. 2010 Dec;27(4):1329-35.

39.

Cancer Genome Atlas Research Network. Integrated genomic analyses of ovarian carcinoma. Nature. 2011 Jun 29;474(7353):609-15.

40.

Chen X, Thiaville MM, Chen L, Stoeck A, Xuan J, Gao M, et al. Defining NOTCH3 target genes in ovarian cancer. Cancer Res. 2012 May 1;72(9):2294-303.

41.

Schott AF, Landis MD, Dontu G, Griffith KA, Layman RM, Krop I, et al. Preclinical and clinical studies of gamma secretase inhibitors with docetaxel on human breast tumors. Clin Cancer Res. 2013 Mar 15;19(6):1512-24.

42.

43.

44.

Chen J, Kesari S, Rooney C, Strack PR, Chen J, Shen H, et al. Inhibition of notch signaling blocks growth of glioblastoma cell lines and tumor neurospheres. Genes Cancer. 2010 Aug;1(8):822-35.

45.

46.

Groeneweg JW, DiGloria CM, Yuan J, Richardson WS, Growdon WB, Sathyanarayanan S, et al. Inhibition of notch signaling in combination with paclitaxel reduces platinum-resistant ovarian tumor growth. Front Oncol. 2014 Jul 7;4:171.

Effects of Notch inhibition and chemotherapy on ovarian CSCs

47.

Rizzo S, Hersey JM, Mellor P, Dai W, Santos-Silva A, Liber D, et al. Ovarian cancer stem cell-like side populations are enriched following chemotherapy and overexpress EZH2. Mol Cancer Ther. 2011 Feb;10(2):325-3.

48.

Kobayashi Y, Seino K, Hosonuma S, Ohara T, Itamochi H, Isonishi S, et al. Side population is increased in paclitaxel-resistant ovarian cancer cell lines regardless of resistance to cisplatin. Gynecol Oncol. 2011 May 1;121(2):390-4.

49.

Steg AD, Bevis KS, Katre AA, Ziebarth A, Dobbin ZC, Alvarez RD, et al. Stem cell pathways contribute to clinical chemoresistance in ovarian cancer. Clin Cancer Res. 2012 Feb 1;18(3):869-81.

50.

Kulkarni-Datar K, Orsulic S, Foster R, Rueda BR. Ovarian tumor initiating cell populations persist following paclitaxel and carboplatin chemotherapy treatment in vivo. Cancer Lett. 2013 Oct 10;339(2):237-46.

51.

52.

Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001 May 1;29(9):e45.

53.

Foster R, Buckanovich RJ, Rueda BR. Ovarian cancer stem cells: Working towards the root of stemness. Cancer Lett. 2013 Sep 10;338(1):147-5.

54.

Yabuuchi S, Pai SG, Campbell NR, de Wilde RF, De Oliveira E, Korangath P, et al. Notch signaling pathway targeted therapy suppresses tumor progression and metastatic spread in pancreatic cancer. Cancer Lett. 2013 Jul 10;335(1):41-5.

55.

Fan X, Khaki L, Zhu TS, Soules ME, Talsma CE, Gul N, et al. NOTCH pathway blockade depletes CD133-positive glioblastoma cells and inhibits growth of tumor neurospheres and xenografts. Stem Cells. 2010 Jan;28(1):516.

56.

Liu YP, Yang CJ, Huang MS, Yeh CT, Wu AT, Lee YC, et al. Cisplatin selects for multidrug-resistant CD133+ cells in lung adenocarcinoma by activating notch signaling. Cancer Res. 2012 Nov 7.

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 4

Gene CD133 CD44 Nanog Oct4 Sox2 β-actin

Forward primer CACTACCAAGGACAAGGCGTTC CCAGAAGGAACAGTGGTTTGGC GTCCCAAAGGCAAACAACCC TGCCCGAAACCCACACTG GGGGAAAGTAGTTTGCTGCC GAGCACAGAGCCTCGCCTTT

Reverse primer CAACGCCTCTTTGGTCTCCTTG ACTGTCCTCTGGGCTTGGTGTT ACCAGGTCTTCACCTGTTTG CTCGGACCACATCCTTCTCG CGCCGCCGATGATTGTTATT TCATCATCCATGGTGAGCTGG

Supplementary Table 1. Primer sequences of the genes analyzed by qPCR.

Effects of Notch inhibition and chemotherapy on ovarian CSCs

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter

Inhibition of gamma-secretase activity impedes uterine serous carcinoma growth in a human xenograft model

Jolijn W. Groeneweg1,2, Tracilyn R. Hall1,2,3, Ling Zhang1, Minji Kim1, Virginia F. Byron1, Rosemary Tambouret2,5, Sriram Sathyanarayanan4, Rosemary Foster1,2,3, Bo R. Rueda1,2,3, Whitfield B. Growdon1,2,3

Vincent Center for Reproductive Biology, Department of Obstetrics and Gynecology, Massachusetts General Hospital, Boston, MA, United States

Harvard Medical School, Boston, MA, United States

Division of Gynecologic Oncology, Department of Obstetrics and Gynecology, Massachusetts General Hospital, Boston, MA, United States

Merck Research Laboratories, Boston, MA, United States

Department of Pathology, Massachusetts General Hospital, Boston, MA, United States

Gynecologic Oncology 2014;133:607-615

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 5

Abstract Objective: Uterine serous carcinoma (USC) represents an aggressive subtype of endometrial cancer. We sought to understand Notch pathway activity in USC and determine if pathway inhibition has anti-tumor activity. Methods: Patient USC tissue blocks were obtained and used to correlate clinical outcomes with Notch1 expression. Three established USC cell lines were treated with gamma-secretase inhibitor (GSI) in vitro. Mice harboring cell line derived or patient derived USC xenografts (PDXs) were treated with vehicle, GSI, paclitaxel and carboplatin (P/C), or combination GSI and P/C. Levels of cleaved Notch1 protein and Hes1 mRNA were determined in GSI treated samples. Statistical analysis was performed using Wilcoxon rank sum and Kaplan-Meier methods. Results: High nuclear Notch1 protein expression was observed in 58% of USC samples with no correlation with overall survival. GSI induced dose-dependent reductions in cell number and decreased levels of cleaved Notch1 protein and Hes1 mRNA in vitro. Treatment of mice with GSI led to decreased Hes1 mRNA expression in USC xenografts. In addition, GSI impeded tumor growth of cell line xenografts as well as UT1 USC PDXs. When GSI and P/C were combined, synergistic anti-tumor activity was observed in UT1 xenografts. Conclusion: Notch1 is expressed in a large subset of USC. GSI-mediated Notch pathway inhibition led to both reduced cell numbers in vitro and decreased tumor growth of USC some xenograft models. When combined with conventional chemotherapy, GSI augmented anti-tumor activity in one USC PDX line suggesting that targeting of the Notch signaling pathway is a potential therapeutic strategy for future investigation.

Notch inhibition in uterine serous carcinoma

Introduction Endometrial cancer is the most prevalent gynecologic malignancy and the fourth leading cancer among women in the United States. In 2014, approximately 52,000 women will be diagnosed with endometrial cancer and more than 8,500 patients will not survive their disease.[1] Investigators have characterized endometrial cancers as either type I or II.[2] Type I carcinomas account for the majority of endometrial cancer and present with early stage, low grade tumors of endometrioid histology. In contrast, type II endometrial cancers are aggressive, high grade subtypes that encompass a spectrum of histologies including carcinosarcoma, clear cell carcinoma and uterine serous carcinoma (USC).[3] Although USC represents the most common type II carcinoma, it accounts for only 10% of all endometrial cancers. USC frequently presents as advanced stage, metastatic disease resistant to conventional chemotherapy, and accounts for a disproportionate 40% of disease-related deaths.[4] Unlike type I endometrial cancers, USC can be primarily treated with cytoreductive surgery followed by platinum-based chemotherapy and radiation treatment.[5] Despite this multi-modality approach, recurrence and chemoresistant disease are common [6] highlighting the need for investigation of novel therapeutic options including targeted therapy. The Notch signaling pathway plays an important role in multiple developmental and cellular processes, including regulation of cell proliferation, differentiation, apoptosis and stem cell self-renewal.[7] In humans, there are four Notch receptors (Notch1-4), each of which can be activated through binding with one of its ligands (Jagged and Delta-like) on neighboring cells. [8] This activation induces proteolytic cleavage of the Notch receptor by a disintegrin and metalloprotease (ADAM), followed by further cleavage by gamma-secretase and release of the Notch intracellular domain (NICD). Subsequent translocation of the NICD to the nucleus leads to transcriptional activation of target genes, such as members of the Hes and Hey families.[8, 9] Deregulation of the Notch pathway has been demonstrated in a variety of malignancies with Notch1 and Notch3 most widely implicated in malignant transformation.[10] Both oncogenic and tumor-suppressive effects of the Notch pathway have been observed.[11] Interestingly, Notch was shown to be one of the most consistently activated signaling pathways in serous ovarian cancer, and scientific reports have supported that Notch signaling contributes to ovarian cancer pathology.[12-14] In contrast, there is limited evidence implicating Notch signaling in endometrial cancer pathogenesis. Some investigators have reported increased

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 5

Notch1 protein expression in endometrioid endometrial cancers with one study also detecting a rise in Notch3 expression.[15-17] In addition, an elevated level of Notch1 or Notch3 protein in endometrioid endometrial carcinoma was significantly associated with worse overall survival.[16] In contrast, one recent study showed a decrease in mRNA levels of all four Notch receptors in endometrioid endometrial tumors, relative to expression in benign endometrium.[18] Although the role of Notch signaling in USC is currently unclear, the similar histology, clinical behavior and genomic profile of serous ovarian tumors and USC suggest that analysis of Notch gene and protein expression in USC could reveal a new therapeutic target in the treatment of this tumor. Given the role of Notch in human cancers, a variety of Notch pathway inhibitors have been developed.[19] Gamma-secretase inhibitors (GSIs) that block the cleavage of all four Notch paralogs are the most frequently utilized Notch-targeting agents.[20] In in vitro and in vivo models of serous ovarian cancer, Notch pathway inhibition led to decreased cell proliferation and xenograft growth, and increased sensitivity to chemotherapeutic agents.[10, 21] No analyses of Notch pathway inhibition in serous endometrial cancer have been reported to date. More recently, in vitro GSI treatment of Ishikawa cells, which were originally derived from a well differentiated endometrial adenocarcinoma, resulted in decreased proliferation and increased apoptosis.[22] In another recent analysis, GSI treatment decreased the invasive potential of the KLE endometrial cancer cell line without inhibiting cell proliferation. [16] These data highlight a possible role for GSI in endometrial cancer therapy. We initially aimed to confirm Notch1 protein expression in a spectrum of endometrioid endometrial cancers. More importantly, since Notch1 protein expression in USC had not been reported, we analyzed nuclear Notch1 expression levels in 45 specimens and correlated our findings with their respective clinical outcomes. In addition, we analyzed the functional significance of Notch signaling in USC biology by determining the effects of the pan-GSI MRK-003 [23-25] on cell proliferation in USC cell lines. GSI-mediated inhibition of the Notch pathway was confirmed by analyzing post-treatment levels of both the Notch1 nuclear intracellular domain (NICD1) and the Notch target gene Hes1 mRNA. Finally, USC cell line derived xenografts as well as USC patient derived xenografts (PDXs) were used to evaluate the anti-tumor activity of MRK-003 as a single agent and in combination with platinumbased chemotherapy to determine if pan-Notch inhibition can synergize with an established therapy. This investigation suggested that nuclear Notch1 levels are increased in high grade endometrioid endometrial cancers and in USC. Gamma-secretase inhibition decreased USC

Notch inhibition in uterine serous carcinoma

cell proliferation in vitro in a dose dependent fashion and down-regulated levels of NICD1 and Hes1. Furthermore, GSI treatment impeded USC xenograft growth in vivo in a subset of cell line derived xenografts and PDXs. Administration of MRK-003 with paclitaxel and carboplatin (P/C) demonstrated synergistic anti-tumor activity in one of two primary USCs that had high nuclear Notch1 expression.

Methods Tissue samples An endometrial cancer tissue microarray consisting of 98 endometrioid endometrial cancers representing the spectrum of grade was obtained from US Biomax, Inc. Following Institutional Review Board (IRB) approval, we identified 45 patients with USC who underwent surgical staging at our institution from 2000 to 2012 and obtained formalin fixed, paraffin embedded (FFPE) tumor blocks of surgically removed USC tissue from each patient. Notch1 immunohistochemistry Following blocking of non-specific binding, sections of the endometrial cancer tissue microarray, primary human USC samples and USC xenograft samples were incubated with a mouse monoclonal anti-Notch1 antibody (Novus Biologicals) overnight at 4ºC. A biotinylated goat anti-mouse secondary antibody (Santa Cruz Biotechnology) was applied for 1 hour at room temperature. VECTASTAIN ABC reagents (Vector Laboratories) and 3,3’-diaminobenzidine chromogen (Dako) were used for visualization of staining. Vector Laboratories’ M.O.M. kit reagents were used according to the manufacturer’s instructions when staining xenograft sections to prevent non-specific staining of mouse cells. All slides were reviewed and scored by a pathologist blinded to the nature of the samples. Notch1 nuclear expression was scored by a pathologist on a 0 - 3+ scale. Cell lines and culture The three established human USC cell lines ARK1, ARK2 and SPEC2 [26, 27] were cultured in either RPMI 1640 medium supplemented with 10% fetal bovine serum (ARK1 and ARK2) or MEM medium containing Earle’s salts and L-glutamine supplemented with 10% fetal bovine serum, 1 mM sodium pyruvate, 2% MEM 100X Vitamin Solution and 1% MEM 100X NonEssential Amino Acids (SPEC2). All three cell lines were incubated at 37ºC in 5% CO2.

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 5

Drugs MRK-003 was provided by Merck Research Laboratories. Paclitaxel was purchased from Sigma-Aldrich and carboplatin was obtained from the clinical pharmacy at our institution. In vitro treatment of USC cell lines For dose response experiments, ARK1, ARK2 and SPEC2 cells were plated on 6-well plates and incubated overnight in their complete growth medium with 1% fetal bovine serum (FBS). A stock of 10 mM MRK-003 in DMSO was diluted in medium containing 1% FBS and cells were treated in duplicate for 48 hours with either medium only or increasing concentrations of MRK-003. Cells were collected and counted after the 48 hour incubation period. To determine the effects of gamma secretase inhibition on Notch1 signaling in vitro, ARK1, ARK2 and SPEC2 cells were treated for 12, 24 and 48 hours with the determined IC50, then harvested and frozen for western blotting analyses. In parallel experiments, cells were collected 6 hours post-treatment for Hes1 quantitative PCR analyses. Generation and propagation of USC xenografts USC cell line derived xenografts were established by subcutaneous (s.c.) injection of cultured cells (suspended in 1:1 PBS with Matrigel, BD Biosciences) into 6 - 8 week old female NOD/ SCID mice (Jackson Laboratory). PDXs were established as previously described.[28] Briefly, primary human USC samples were obtained under an institutional review board approved prospective tissue collection protocol. Following processing and depletion of endothelial and hematopoietic cells, tumor derived cells were suspended in 1:1 PBS with Matrigel and injected s.c. into 6 - 8 week old female NOD/SCID mice. All mouse experiments were performed in accordance with protocols approved by the Institutional Animal Care and Use Committee. Tumor formation in mice was monitored regularly. When xenografts had reached a diameter of 15 - 20 mm, mice were euthanized by CO2 inhalation. The tumors were excised and enzymatically processed to generate a single cell suspension that was depleted of H-2Kd positive mouse cells, re-suspended in PBS/Matrigel (1:1) matrix and re-injected s.c. into female NOD/SCID mice. Serial transplantation of the USC xenografts generated cohorts of 30 mice who each harbored a xenograft derived from the same primary USC. Treatment of mice bearing USC xenografts Mice harboring xenografts derived from ARK1, ARK2 or SPEC2 cells were randomly divided into two arms of 5 - 6 mice with equivalent tumor volumes. One group was treated with MRK-003 (300 mg/kg) and the control group received its vehicle (0.5% methylcellulose), once

Notch inhibition in uterine serous carcinoma

weekly by oral gavage. Two cohorts of mice (n = 20 - 24) harboring UT1 or UT2 PDXs were randomized into four groups and subjected to one of the following treatment regimens: 1) vehicle control comprising intra-peritoneal (IP) injection of cremophor:ethanol 1:1 (paclitaxel vehicle) and saline (carboplatin vehicle) and oral gavage delivery of 0.5% methylcellulose (MRK-003 vehicle); 2) IP administration of 15 mg/kg paclitaxel and 50 mg/kg carboplatin (P/C) and oral gavage of the MRK-003 vehicle; 3) oral gavage delivery of 300 mg/kg MRK-003 and IP administration of the P/C vehicles; and 4) simultaneous administration of MRK-003 (300 mg/kg) by oral gavage and P/C (paclitaxel 15 mg/kg and carboplatin 50 mg/kg) by IP injection. All treatments were done once weekly. Tumors were measured every 3 - 4 days with calipers, and mice were weighed weekly. Tumor volumes (mm3) were calculated using the formula [length in mm x width in mm x width in mm] / 2. Treatment periods were 16 - 28 days. At the end of each experiment, mice were euthanized and tumors were harvested. Portions of each xenograft were snap frozen as well as fixed in formaldehyde and embedded in paraffin for further analyses. In order to analyze Notch pathway activity following acute treatment with MRK-003, mice harboring ARK1, ARK2, SPEC2 or UT1 xenografts were treated with a single dose of MRK-003 (300 mg/kg) or its vehicle. Mice were euthanized 6 hours or 24 hours after treatment. In each experiment a single mouse was treated with either MRK-003 or its vehicle at each time point. Tumors were harvested and a portion of each was either snap frozen or fixed in formaldehyde and embedded in paraffin. Western blotting Lysates were prepared from frozen xenograft samples or pelleted cells using Mammalian Protein Extraction Reagent (Thermo Scientific) supplemented with inhibitors of endogenous protease, kinase and phosphatase activity (Sigma-Aldrich). Twenty to fifty micrograms of protein from each sample were resolved on a polyacrylamide gel and transferred to a PVDF membrane (Millipore). Following blocking, membranes were probed with a rabbit anti-cleaved Notch1 antibody (Val1744, 1:1000, Cell Signaling) overnight at 4ยบC, washed, incubated with a horseradish peroxidase (HRP) conjugated goat anti-rabbit secondary antibody (1:2000, Santa Cruz Biotechnology) and developed using a chemiluminescent detection reagent (ECL Prime, GE Healthcare Life Sciences). Equivalent protein loading was verified by stripping the blots and re-probing with a mouse anti-Pan-actin antibody (NeoMarkers).

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 5

Quantitative PCR analysis RNA was extracted from tumor tissue or cells with a GenElute mammalian RNA extraction kit (Sigma-Aldrich), according to the manufacturer’s instructions. Following synthesis of cDNA with the SuperScript VILO kit (Life Technologies), quantitative real-time PCR (qPCR) analysis was performed using SsoAdvanced SYBR Green Supermix (Bio-Rad Laboratories) on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad). The following primers were used: Hes1 5’-ATTCCTCGTCCCCGGTGGCT-3’ (forward), 5’-TCCAGCTTGGAATGCCGCGAG-3’ (reverse), and β-actin 5’- GAGCACAGAGCCTCGCCTTT-3’ (forward), 5’- TCATCATCCATGGTGAGCTGG-3’ (reverse). Relative expression of Hes1 mRNA was calculated as previously described.[29] Statistical analysis Clinical parameters were correlated utilizing linear and logistic regression, and survival was analyzed utilizing the Kaplan-Meier method. Non-parametric Wilcoxon rank sum tests were performed to determine whether observed differences in xenograft growth and mouse weight between the different treatment groups were statistically significant. Stata software (version 11.1, StataCorp, LP) was used, and a p-value of ≤ 0.05 was considered statistically significant.

Results Prevalence of Notch1 expression in endometrioid endometrial cancer and correlation with histologic grade A tissue microarray comprising 98 endometrioid endometrial cancers of various histologic grades was screened for Notch1 nuclear expression by IHC. High Notch1 expression (nuclear Notch1 staining with 2+ or 3+ intensity) was observed in 12% of endometrioid endometrial cancers (Figure 1A). High nuclear Notch1 levels were found in 10% of low grade (grade 1 and 2) endometrial cancers, as compared to 16% in high grade (grade 3 and undifferentiated) tumors and there was no statistical differences appreciated amongst endometrioid tumors (p = 0.33, Figure 1B).

Notch inhibition in uterine serous carcinoma

Histology

Number of specimens

Notch1 positive, n (%)

Low-grade endometrial cancer Grade 1 endometrioid Grade 2 endometrioid

61 16 45

6 (9.8) 4 (25.0) 2 (4.4)

High-grade endometrial cancer Grade 3 endometrioid Undifferentiated

37 30 7

6 (16.2) 3 (10.0) 3 (42.9)

Figure 1. High nuclear Notch1 protein levels were observed in 12% of endometrioid endometrial cancers on a tissue microarray. The intensity of nuclear immunohistochemical staining was scored by a pathologist as 0, 1+, 2+ or 3+. High expression was defined as a score of 2+ or 3+. A) Representative images of Notch1 immunostaining in endometrioid endometrial cancers of different histological grades: upper left) grade 1, nuclear staining score 2+; upper right) grade 2, nuclear staining score 2+; lower left) grade 3, nuclear staining score 2+; lower right) undifferentiated, nuclear staining score 3+. B) Analysis of IHC findings stratified by tumor grade showed no differences in expression within the endometrioid cohort (p = 0.33).

Prevalence of Notch1 expression in USC and correlation with clinical outcomes We next analyzed nuclear Notch1 expression in a cohort of 45 patient USC tissue blocks. The clinical characteristics of the patients are summarized in Supplemental Table 1. Mean age of the cohort was 68 years, and a full spectrum of disease stage was represented. Overall survival was 2.1 years from diagnosis. IHC revealed high nuclear Notch1 levels (2+ or 3+ intensity) in 26 of 45 USCs (58%, Figure 2A) with greater nuclear Notch1 expression in USC

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 5

compared to expression in the tested endometrioid samples (p < 0.001). High expression of Notch1 in the nucleus was not associated with overall survival with a median of 2.9 years compared to 1.6 years (p = 0.3, Figure 2B).

Figure 2. High nuclear Notch1 levels (2+/3+ intensity of immunostaining) were observed in 58% of USC tissues, and did not associate with overall survival. A) Representative images of differential nuclear Notch1 immunostaining in four USC specimens: upper left) nuclear staining score 0; upper right) nuclear staining score 1+; lower left) nuclear staining score 2+; lower right) nuclear staining score 3+. B) Kaplan-Meier analysis of the correlation between nuclear Notch1 protein levels and overall survival of the 45 USC patients whose tissue was used for Notch1 IHC. Low Notch1 expression was defined as 0/1+ and high Notch1 expression as 2+/3+. No significant difference in overall survival was found, with a median of 2.9 years for patients whose tumor showed high nuclear Notch1 levels as opposed to 1.6 years for those with low nuclear Notch1 staining (p = 0.3).

Notch inhibition in uterine serous carcinoma

Gamma-secretase inhibition with MRK-003 in USC cell lines ARK1, ARK2 and SPEC2 cells were incubated with increasing concentrations of MRK-003 for 48 hours followed by quantification of viable cells. A dose dependent reduction in cell count was observed for all cell lines after treatment with MRK-003 as compared to their respective controls, with IC50 values in the 2.5- 5 ÂľM range (Figure 3A). Western blotting analysis revealed that treatment with the relevant MRK-003 IC50 concentration markedly decreased the levels of cleaved Notch1 in all three cell lines relative to levels in untreated cells. This GSI-induced decrease was durable over a 48-hour period (Figure 3B). In addition, qPCR analyses showed decreased Hes1 mRNA levels in cells collected 6 hours after MRK-003 treatment, compared to levels in untreated control cells (Figure 3C). Gamma-secretase inhibition with MRK-003 in mice bearing USC cell line derived xenografts Mouse cohorts harboring USC cell line derived xenografts were treated with MRK-003 or vehicle. As shown in Figure 4A, monotherapy with MRK-003 impeded tumor growth of ARK1 and ARK2 xenografts but had no effect on the growth of SPEC2 xenografts. The inhibitory effect of MRK-003 was found to be significant at day 21 and day 10 in ARK1 and ARK2 tumors, respectively (both p < 0.03). The mice receiving MRK-003 showed no signs of toxicity such as weight loss (Supplemental figure 1A). Immunohistochemical and western blotting analyses of untreated ARK1, ARK2 and SPEC2 cell line derived xenografts revealed that baseline protein levels of Notch1 intracellular domain (NICD1) did not correlate with the observed response to MRK-003 treatment (Figure 4B and 4C).

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 5

Figure 3. In vitro treatment of USC cell lines with MRK-003 decreased cell viability as well as cleaved Notch1 and Hes1 levels. A) ARK1, ARK2 and SPEC2 cells were treated in duplicate with increasing concentrations of MRK-003 and viable cells were counted after a 48-hour incubation period. A dose dependent reduction in cell numbers was observed in each cell line. Average relative changes in cell counts compared to the untreated control are shown. Error bars represent the standard error of the mean. B) Cell lines were treated with 5 µM (ARK1 and SPEC2) or 2.5 µM (ARK2) MRK-003 or medium only and collected 12 hours, 24 hours or 48 hours later. The harvested cells were subjected to western blotting analysis of gamma-secretase cleaved Notch1 (Val1744). Markedly reduced levels of NICD1 were detected in all MRK-003 treated samples. C = control, M = MRK-003. Expression of Pan-actin was used as loading control. C) qPCR analyses of ARK1, ARK2 and SPEC2 cells harvested 6 hours after treatment with 5 µM (ARK1 and SPEC2) or 2.5 µM (ARK2) MRK-003 revealed decreased Hes1 mRNA levels (normalized to β-actin expression) compared to untreated control cells.

Notch inhibition in uterine serous carcinoma

Figure 4. Monotherapy with MRK-003 in vivo inhibits tumor growth of ARK1 and ARK2 xenografts. A) Mice bearing xenografts derived from ARK1 (left), ARK2 (center), or SPEC2 (right) cells were divided into two cohorts which received either MRK-003 or vehicle. Tumors were measured twice weekly, and the percent change in tumor volume compared to the baseline volume (100%) is shown. Error bars represent the standard error of the mean. Asterisks signify a p-value of < 0.03. B) Notch1 IHC analysis of untreated ARK1 (left), ARK2 (center), and SPEC2 (right) cell line derived xenografts. Nuclear staining intensity in ARK1 and ARK2 xenografts was scored as 1+, and SPEC2 xenograft cells showed 2+ nuclear staining intensity. C) Cleaved Notch1 (NICD1) western blotting analysis of untreated ARK1, ARK2, and SPEC2 cell line derived xenografts. Pan-actin was used as a loading control.

Gamma-secretase inhibition with standard chemotherapy in mice bearing primary USC derived xenografts Xenograft tumors were generated from two independent primary human USC specimens (UT1 and UT2) and used to study the anti-tumor activity of MRK-003 as a monotherapy and in combination with P/C. Treatment with P/C alone reduced growth of both UT1 and UT2 PDXs, and administration of MRK-003 as single agent resulted in a decrease of UT1 tumor growth(p â&#x2030;¤ 0.05, Figure 5A). In addition, combination therapy with MRK-003 and P/C showed synergistic anti-tumor activity against UT1 xenografts, compared to P/C alone and MRK-003 alone (p = 0.05 and 0.004, respectively, Figure 5A). Weight loss was observed in those animals bearing UT2 xenografts that received P/C (p < 0.01). Weight loss was not associated with MRK-003 treatment in either of the 4-arm dosing experiments (Supplementary figure 1B).

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 5

IHC and western blotting analyses of tumor samples derived from untreated mice revealed differential baseline NICD1 levels in UT1 when compared to UT2. The UT1 xenograft had relatively greater NICD1 levels compared to those in the UT2 xenograft (Figure 5B and 5C). A response to MRK-003 monotherapy and a synergistic effect of MRK-003 with P/C was only observed in the UT1 xenograft cohort.

Figure 5. A synergistic effect of MRK-003 with P/C was observed in one of two primary USC xenograft cohorts. A) Mice harboring UT1 (left) or UT2 (right) PDXs were treated with either vehicle, MRK-003 alone, P/C alone or the combination of MRK-003 and P/C. Tumors were measured twice weekly, and the percent change in tumor volume compared to baseline volume (100%) is shown. Treatment with MRK-003 alone decreased tumor growth of UT1 xenografts (p = 0.05) and the combination of MRK-003 and P/C was more effective in reducing UT1 tumor growth than either treatment alone (p â&#x2030;¤ 0.05). No significant anti-tumor activity of MRK-003 was observed in UT2 xenografts. Error bars represent the standard error of the mean. Asterisks signify a p-value of â&#x2030;¤ 0.05. B) Notch1 IHC analysis of UT1 (left) and UT2 (right) primary USC specimens and untreated xenografts derived from these primary tumors. Nuclear staining intensity in both primary and xenograft UT1 samples was scored as 3+, whereas UT2 primary and xenograft samples showed nuclear staining of 1+ intensity. C) Western blotting analysis of cleaved Notch1 (NICD1) levels in untreated UT1 and UT2 xenografts. Pan-actin levels were used as a loading control.

Effects of in vivo MRK-003 therapy on Hes1 gene expression To confirm that MRK-003 targeted Notch pathway signaling, we measured the effect of chronic and acute MRK-003 treatment on expression of the Notch target gene Hes1. ARK1, ARK2,

100

Notch inhibition in uterine serous carcinoma

SPEC2, UT1 and UT2 xenografts were harvested after completion of the in vivo treatment studies shown in Figures 4A and 5A. Hes1 mRNA levels in these tumors were assessed by qPCR. A significant decrease in Hes1 expression was observed in ARK1 (p<0.04), ARK2 (p<0.02), UT1 (p<0.005) and UT2 (p<0.003) xenografts following chronic MRK-003 therapy, compared with vehicle treated control samples (Figure 6A). This effect was not seen in SPEC2 xenografts which did not respond to GSI treatment. To confirm on target effects, cell line derived and UT1 xenograft samples obtained 6 or 24 hours after treatment with a single dose of MRK-003 or vehicle were used for Hes1 qPCR analyses. Acute treatment with MRK-003 resulted in decreased transcript levels of Hes1 in all cohorts analyzed, as compared to vehicle (Figure 6B).

Figure 6. In vivo treatment with MRK-003 decreases Hes1 transcript levels. A) Hes1 mRNA levels in MRK-003 or vehicle treated tumors harvested at the completion of the in vivo treatment period were determined by qPCR. For each experiment, four MRK-003 treated samples and four vehicle treated samples were analyzed. MRK-003 therapy led to significant decreases in levels of Hes1 mRNA in all tumors (p < 0.05), with the exception of SPEC2 where no difference in Hes1 expression was observed (p = 0.24). Average relative Hes1 transcript levels, normalized to Î˛-actin and compared with the average Hes1 expression of the vehicle treated control samples, are shown. Error bars represent the standard error of the mean. B) qPCR analyses of ARK1, ARK2, SPEC2 and UT1 xenografts collected after acute treatment with MRK-003 for 6 or 24 hours revealed reduced levels of Hes1 mRNA in all tumors, compared with vehicle treated tumors. Relative Hes1 transcript levels, normalized to Î˛-actin, are shown.

101

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 5

Discussion In this study, we demonstrate that nuclear Notch1 is expressed in a significant proportion of endometrioid endometrial cancers (12%) as well as in the majority of analyzed USC (58%). In addition, treatment with the gamma-secretase inhibitor MRK-003 decreased proliferation of USC cell lines in vitro and restricted growth of xenografts derived from USC cell lines and primary human USC tissue in vivo. Moreover, MRK-003 treatment augmented the anti-tumor activity of standard P/C in one of two primary human USC xenograft cohorts. Collectively, these data highlight Notch as a potential therapeutic target in a subset of USC. The role of Notch signaling in the pathology of cancer has been widely investigated. Members of the Notch pathway have been implicated in numerous solid and hematologic malignancies. [19] Investigators have described expression of the Notch receptors in endometrial cancer [15-18] and only two of them reported detection of NICD1.[15, 17] We also observed high Notch1 nuclear levels in a subset of endometrioid endometrial cancers representing different histologic grades. To our knowledge, this is the first report examining NICD1 in a USC cohort. Our data show strong nuclear Notch1 immunostaining in a higher proportion of tumors compared with endometrioid endometrial cancer. Although levels of total Notch1 protein and mRNA and advanced stage disease are correlated in serous ovarian cancer [30], high nuclear Notch1 protein levels in USC were not found to associate with advanced stage disease or decreased survival in our sample population. The poor overall survival (2.1 years) of this USC cohort is distinct from the broad range of outcomes commonly observed in ovarian cancer, with median survival rates of up to 5 years [31], and may mask any correlation between survival and Notch1 expression. Monotherapy with MRK-003 reduced tumor growth moderately in a subset of USC xenografts derived from both cell lines and primary tumors. A decrease in cleaved Notch1 as well as decreased expression of the Notch target gene Hes1 following MRK-003 treatment confirmed inhibition of Notch signaling by this GSI. These results are consistent with previous studies describing the preclinical effectiveness of MRK-003 in a variety of cancers including lung cancer, breast cancer, pancreatic cancer and acute lymphoblastic leukemia.[25, 32] The clinical analog to MRK-003, MK-0752, is currently being tested as a treatment against several solid tumors.[33, 34] A recent phase I study of MK-0752 demonstrated anti-tumor activity in a subset of patients with glioma and demonstrated that gamma-secretase inhibition led to alterations in mRNA transcript levels of Notch target genes.[34] The authors concluded that

102

Notch inhibition in uterine serous carcinoma

MK-0752 was generally well tolerated in phase I trial. In our preclinical in vivo experiments using MRK-003, no signs of toxicity were observed. Interestingly, the addition of MRK-003 to standard P/C chemotherapy enhanced inhibition of tumor growth in one of two analyzed primary USC xenograft cohorts. This differential response could be attributed to any number of factors and its biological basis remains to be determined. Synergy between GSIs and chemotherapeutic agents has been described previously in other solid tumors including ovarian cancer, although the mechanism remains unknown.[10, 21, 24] Investigators have hypothesized that targeting of the Notch pathway may selectively inhibit tumor initiating cell populations that are less sensitive to cytotoxic therapy. The improvement in tumor response observed with combination therapy would therefore be the result of cytotoxic effects on the bulk tumor cells as well as the inhibition by GSI of tumor initiating cells that serve to re-populate bulk tumor daughter cells.[35] This hypothesis has gained traction in both breast and ovarian cancer where investigators have described how GSI alter the cellular landscape and selectively decrease cellular populations that express phenotypic markers of stem cells such as CD133, CD44 and ALDH enzymatic activity.[10, 21] Whether or not GSI targets a stem cell-like population in USC remains to be determined. Unlike the majority of endometrial cancers, USC portends a poor prognosis mainly due to a high recurrence rate. The development of targeted therapies, therefore, is crucial to improving therapeutic options for women with USC. Many studies on potential molecular targets in USC have focused on HER2 (ERBB2) gene amplification, which has been observed in 17-30% of USC samples.[36-38] Two USC cell lines and one primary tumor used in this study (ARK1, ARK2 and UT2) harbor HER2 gene amplification (data not shown). In breast cancer, crosstalk between Notch1 signaling and HER2 activity has been described.[39, 40] Treatment with a GSI increased the efficacy of HER2 inhibition and prevented breast tumor recurrence after treatment with the HER2 inhibitor trastuzumab.[39, 40] Our studies suggest that USC has a high prevalence of Notch1 expression and sensitivity to GSI. The frequent presence of HER2 gene amplification in USC further suggests that combination targeting of HER2 and Notch may hold promise for a subset of USC. Our studies, albeit with a limited number of samples, did not reveal an association between HER2 gene amplification and tumor response to single agent GSI therapy.

103

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 5

The current investigation is limited by the small sample size for treatment studies and the lack of a clear marker associated with response to GSI. Synergistic activity between GSI and P/C was observed only in the UT1 primary USC sample which had high (3+) baseline nuclear Notch1 expression. Nuclear Notch1 levels were lower in UT2 which did not demonstrate the synergistic response. Although provocative, these data are limited and no conclusions regarding the use of nuclear Notch1 expression as a biomarker associated with either response to GSI or synergy with conventional chemotherapy can be inferred. Moreover, both immunohistochemical and western blotting analyses of NICD1 in untreated ARK1, ARK2 and SPEC2 xenografts showed the highest NICD1 levels in SPEC2 tumors which did not respond to single agent MRK-003 treatment in vivo. Identification of a marker that could be used to select tumors for treatment with a GSI is of pivotal importance. Further functional studies of all the Notch receptors, baseline gamma-secretase enzymatic activity and their downstream effectors will be required to identify an appropriate marker for response. This study investigated the functional significance of Notch pathway inhibition as a therapy for USC. Pan inhibition of Notch signaling with the GSI MRK-003 induced on target effects and reduced tumor growth in a subset of USCs. In addition, the observed synergistic effect of MRK-003 with conventional P/C in one primary USC PDX provides pilot data to suggest that the combination of a Notch inhibitor and standard chemotherapy may have promise in the management of USC.

104

Notch inhibition in uterine serous carcinoma

References 1.

Siegel R, Naishadham D, Jemal A. Cancer statistics, 2013. CA Cancer J Clin. 2013;63:11-30.

Bokhman JV. Two pathogenetic types of endometrial carcinoma. Gynecol Oncol. 1983;15:10-7.

Amant F, Moerman P, Neven P, Timmerman D, Van Limbergen E, Vergote I. Endometrial cancer. Lancet. 2005;366:491-505.

Boruta DM, 2nd, Gehrig PA, Fader AN, Olawaiye AB. Management of women with uterine papillary serous cancer: a Society of Gynecologic Oncology (SGO) review. Gynecol Oncol. 2009;115:142-53.

del Carmen MG, Birrer M, Schorge JO. Uterine papillary serous cancer: a review of the literature. Gynecol Oncol. 2012;127:651-61.

Artavanis-Tsakonas S, Rand MD, Lake RJ. Notch signaling: cell fate control and signal integration in development. Science. 1999;284:770-6.

Bray SJ. Notch signalling: a simple pathway becomes complex. Nat Rev Mol Cell Biol. 2006;7:678-89.

Kopan R, Ilagan MX. The canonical Notch signaling pathway: unfolding the activation mechanism. Cell. 2009;137:216-33.

10.

11.

Avila JL, Kissil JL. Notch signaling in pancreatic cancer: oncogene or tumor suppressor? Trends Mol Med. 2013;19:320-7.

12.

Park JT, Li M, Nakayama K, Mao TL, Davidson B, Zhang Z, et al. Notch3 gene amplification in ovarian cancer. Cancer Res. 2006;66:6312-8.

13.

Chen X, Thiaville MM, Chen L, Stoeck A, Xuan J, Gao M, et al. Defining NOTCH3 target genes in ovarian cancer. Cancer Res. 2012;72:2294-303.

14.

Integrated genomic analyses of ovarian carcinoma. Nature. 2011;474:609-15.

15.

Mori M, Miyamoto T, Ohno S, Miyake Y, Sakaguchi T, Ohno E. Diagnostic utility of notch-1 immunocytochemistry in endometrial cytology. Acta Cytol. 2012;56:166-70.

16.

Mitsuhashi Y, Horiuchi A, Miyamoto T, Kashima H, Suzuki A, Shiozawa T. Prognostic significance of Notch signalling molecules and their involvement in the invasiveness of endometrial carcinoma cells. Histopathology. 2012;60:826-37.

17.

Cobellis L, Caprio F, Trabucco E, Mastrogiacomo A, Coppola G, Manente L, et al. The pattern of expression of Notch protein members in normal and pathological endometrium. J Anat. 2008;213:464-72.

18.

Jonusiene V, Sasnauskiene A, Lachej N, Kanopiene D, Dabkeviciene D, Sasnauskiene S, et al. Down-regulated expression of Notch signaling molecules in human endometrial cancer. Med Oncol. 2013;30:438.

19.

Takebe N, Nguyen D, Yang SX. Targeting Notch signaling pathway in cancer: Clinical development advances challenges. Pharmacol Ther. 2013.

20.

Rizzo P, Osipo C, Foreman K, Golde T, Osborne B, Miele L. Rational targeting of Notch signaling in cancer. Oncogene. 2008;27:5124-31.

21.

Schott AF, Landis MD, Dontu G, Griffith KA, Layman RM, Krop I, et al. Preclinical and clinical studies of gamma secretase inhibitors with docetaxel on human breast tumors. Clinical cancer research : an official journal of the American Association for Cancer Research. 2013;19:1512-24.

22.

Mori M, Miyamoto T, Yakushiji H, Ohno S, Miyake Y, Sakaguchi T, et al. Effects of N-[N-(3, 5-difluorophenacetylL-alanyl)]-S-phenylglycine t-butyl ester (DAPT) on cell proliferation and apoptosis in Ishikawa endometrial cancer cells. Hum Cell. 2012;25:9-15.

105

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 5

23.

24.

25.

26.

Morgan J, Hoekstra AV, Chapman-Davis E, Hardt JL, Kim JJ, Buttin BM. Synuclein-gamma (SNCG) may be a novel prognostic biomarker in uterine papillary serous carcinoma. Gynecol Oncol. 2009;114:293-8.

27.

English DP, Roque DM, Carrara L, Lopez S, Bellone S, Cocco E, et al. HER2/neu gene amplification determines the sensitivity of uterine serous carcinoma cell lines to AZD8055, a novel dual mTORC1/2 inhibitor. Gynecol Oncol. 2013.

28.

29.

Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29:e45.

30.

Wang M, Wang J, Wang L, Wu L, Xin X. Notch1 expression correlates with tumor differentiation status in ovarian carcinoma. Med Oncol. 2010;27:1329-35.

31.

Armstrong DK, Bundy B, Wenzel L, Huang HQ, Baergen R, Lele S, et al. Intraperitoneal cisplatin and paclitaxel in ovarian cancer. N Engl J Med. 2006;354:34-43.

32.

33.

34.

35.

Pannuti A, Foreman K, Rizzo P, Osipo C, Golde T, Osborne B, et al. Targeting Notch to target cancer stem cells. Clinical cancer research : an official journal of the American Association for Cancer Research. 2010;16:314152.

36.

Slomovitz BM, Broaddus RR, Burke TW, Sneige N, Soliman PT, Wu W, et al. Her-2/neu overexpression and amplification in uterine papillary serous carcinoma. J Clin Oncol. 2004;22:3126-32.

37.

38.

Odicino FE, Bignotti E, Rossi E, Pasinetti B, Tassi RA, Donzelli C, et al. HER-2/neu overexpression and amplification in uterine serous papillary carcinoma: comparative analysis of immunohistochemistry, real-time reverse transcription-polymerase chain reaction, and fluorescence in situ hybridization. Int J Gynecol Cancer. 2008;18:14-21.

39.

Pandya K, Meeke K, Clementz AG, Rogowski A, Roberts J, Miele L, et al. Targeting both Notch and ErbB2 signalling pathways is required for prevention of ErbB-2-positive breast tumour recurrence. Br J Cancer. 2011;105:796-806.

40.

Osipo C, Patel P, Rizzo P, Clementz AG, Hao L, Golde TE, et al. ErbB-2 inhibition activates Notch-1 and sensitizes breast cancer cells to a gamma-secretase inhibitor. Oncogene. 2008;27:5019-32.

106

Notch inhibition in uterine serous carcinoma

Characteristics

n (%)

Age (mean)

68.5

Stage I II III IV

18 (40) 1 (2) 14 (31) 12 (27)

Overall survival (mean)

2.1

Adjuvant chemotherapy Yes No NA

35 (78) 8 (18) 2 (4)

Radiation

Yes No NA

11 (25) 32 (71) 2 (4)

Chemotherapy for recurrence Yes No NA

17 (37) 25 (56) 3 (7)

Radiation for recurrence Yes No NA

4 (9) 38 (84) 3 (7)

Supplementary Table 1. Clinical characteristics of the retrospective cohort of USC patients whose tissue blocks were utilized for Notch1 immunohistochemical analysis. NA represents data that was not available.

107

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 5

Supplementary Figure 1. Mouse weight changes over the course of each treatment study. A) Single agent MRK-003 treatment did not affect mouse weight in ARK1 (left), ARK2 (center) or SPEC2 (right) xenograft cohorts. B) In the UT1 (left) and UT2 (right) experiments, no differences in mouse weights were observed between mice treated with MRK-003 and the ones receiving vehicle. Mice with UT2 xenografts that were treated with P/C showed significant weight loss (p < 0.01) which was not observed in mice harboring UT1 xenografts that received P/C.

108

Notch inhibition in uterine serous carcinoma

109

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Part II The HER2 receptor as therapeutic target in uterine serous carcinoma

Chapter

Dual HER2 targeting impedes growth of HER2 gene amplified uterine serous carcinoma xenografts

Jolijn W. Groeneweg1,2, Silvia F. Hernandez1,2, Virginia F. Byron1, Celeste M. DiGloria1, Hector Lopez4, Vanessa Scialabba4, Minji Kim1, Ling Zhang1, Darrell R. Borger2,4, Rosemary Tambouret2,5, Rosemary Foster1,2,3, Bo R. Rueda1,2,3, Whitfield B. Growdon1,2,3

Vincent Center for Reproductive Biology, Department of Obstetrics and Gynecology, Massachusetts General Hospital, Boston, MA, United States

Harvard Medical School, Boston, MA, United States

Division of Gynecologic Oncology, Department of Obstetrics and Gynecology, Massachusetts General Hospital, Boston, MA, United States

Department of Medicine, Cancer Center, Massachusetts General Hospital, Boston, MA, United States

Department of Pathology, Massachusetts General Hospital, Boston, MA, United States

Clinical Cancer Research 2014;20:6517-6528

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 6

Abstract Objective: Uterine serous carcinoma (USC) is an aggressive subtype of endometrial cancer that commonly harbors HER2 gene amplification. We investigated the effectiveness of HER2 inhibition using lapatinib and trastuzumab in vitro and in xenografts derived from USC cell lines and USC patient derived xenografts. Methods: Immunohistochemistry and fluorescence in situ hybridization were performed to assess HER2 expression in 42 primary USC specimens. ARK1, ARK2 and SPEC2 cell lines were treated with trastuzumab or lapatinib. Cohorts of mice harboring xenografts derived from ARK2 and SPEC2 cell lines and EnCa1 and EnCa2 primary human USC samples were treated with either vehicle, trastuzumab, lapatinib or the combination of trastuzumab and lapatinib. Acute and chronic post treatment tumor samples were assessed for downstream signaling alterations and examined for apoptosis and proliferation. Results: HER2 gene amplification (24%) correlated significantly with HER2 protein overexpression (55%). All models were impervious to single agent trastuzumab treatment. Lapatinib decreased in vitro proliferation of all cell lines and in vivo growth of HER2 amplified xenografts (ARK2, EnCa1). In addition, dual therapy with trastuzumab and lapatinib resulted in significant anti-tumor activity only in ARK2 and EnCa1 tumors. Dual HER2 therapy induced on target alteration of downstream MAPK and PI3K pathway mediators only in HER2 amplified models, and was associated with increased apoptosis and decreased proliferation. Conclusion: Although trastuzumab alone did not impact USC growth, dual anti-HER2 therapy with lapatinib led to improved inhibition of tumor growth in HER2 amplified USC and may be a promising avenue for future investigation.

114

Dual HER2 therapy precludes uterine serous carcinoma xenograft growth

Introduction Endometrial cancer is the most common gynecologic malignancy affecting nearly 50,000 women in the United States annually.[1] Approximately 80-85% of women who undergo comprehensive surgical staging with or without post-operative radiation therapy will be cured of their disease with a low recurrence risk.[2, 3] In contrast, the distinct subset of women who present with high-grade carcinomas of various histologic types including high-grade endometrioid, uterine serous carcinoma (USC) and carcinosarcoma are at increased risk for recurrence of aggressive disease and chemotherapy resistance.[4, 5] These cases account for the majority of the 8,000 annual deaths from endometrial cancer.[5-8] The limitations of conventional cytotoxic and radiation therapies to treat women with these aggressive tumors highlight the dire need for scientific investigation to understand molecular signatures that may confer sensitivity to targeted therapy. Human epidermal growth factor receptor 2 (HER2), also called HER2/neu or c-erbB2, is a well-characterized member of the human epidermal growth factor receptor superfamily that consists of three other tyrosine kinase receptors (HER1/EGFR, HER3 and HER4).[9] The HER2 gene encodes a 185-kDa transmembrane tyrosine kinase receptor and is located on chromosome 17q21. When activated, HER2 can dimerize and induce signal transduction through the mitogen-activated protein kinase (MAPK) and phosphatidylinositol 3-kinase (PI3K) signaling pathways.[10] This downstream activation leads to induction of genes that can promote oncogenic transformation via cell survival, proliferation, angiogenesis and metastasis. Unlike the other epidermal growth factor receptors, HER2 has no known ligand, highlighting the fact that it may be constitutively activated and could act independently to drive an invasive phenotype.[9] Amplification of the HER2 (ERBB2) gene and over-expression of the HER2 protein have been described in many human malignancies including breast, colon, gastric, esophageal, ovarian and endometrial. For some of these cancers, anti-HER2 therapies have become a mainstay of treatment.[11, 12] HER2 protein over-expression or gene amplification has been utilized most successfully in breast cancer as a potent biomarker to select those women most likely to respond to antiHER2 therapies, such as trastuzumab, a monoclonal antibody, or lapatinib, a small molecule tyrosine kinase inhibitor. In breast cancer, nearly 30% of tumors have been found to harbor HER2 expression via gene amplification or protein over-expression, and are thus designated as HER2 â&#x20AC;&#x153;positiveâ&#x20AC;?. While HER2 over-expression was initially associated with the most guarded

115

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 6

prognosis in breast cancer, the advent of targeted anti-HER2 therapy has resulted in women with HER2 positive tumors having one of the most favorable prognoses.[12, 13] Currently, trastuzumab, pertuzumab (both humanized monoclonal antibodies to the HER2 extracellular domain), trastuzumab emantisine (antibody conjugate to cytotoxic mertansine) as well as lapatinib (a dual HER1/HER2 small molecular tyrosine kinase inhibitor) are FDA approved agents for women with HER2 positive local and metastatic breast cancer to be used in concert with conventional cytotoxic chemotherapy.[14-17] Like breast cancer, USC has been shown to harbor a 10% to 30% rate of HER2 gene amplification, with up to 70% of tumors exhibiting HER2 protein over-expression.[18-20] HER2 over-expressing USC has been associated with decreased overall survival.[19] Preclinical in vitro data has suggested that cells derived from HER2 gene amplified USC tumors are more responsive to anti-HER2 therapies compared to cells derived from non-amplified tumors.[21] Despite promising preclinical data, the two published phase II trials of anti-HER2 therapy in recurrent endometrial cancer manifested poor responses. One trial evaluated the efficacy of lapatinib in patients with persistent or recurrent endometrial cancer regardless of histology and HER2 status, and found a 3% partial response rate.[22, 23] Another recent phase II trial pre-selected patients with HER2 positive recurrent endometrial tumors and administered the HER2 monoclonal antibody trastuzumab.[24] Unlike an extensive body of breast and gastric cancer literature suggesting HER2 over-expression to be a biomarker for response to antiHER2 therapy [25, 26], trastuzumab treatment revealed no responses in this trial with HER2 positive endometrial cancer patients.[24] While there is disagreement regarding why lapatinib and trastuzumab as single agents failed to demonstrate any significant durable clinical benefit in endometrial cancer, these trials suggest that single agent anti-HER2 therapies have limited effect, possibly due to innate or drug-induced resistance pathways.[27] In breast cancer, investigators are propounding the concept of dual anti-HER2 therapy, where biologic therapeutics targeting different aspects of the HER2 protein may someday obviate the need for conventional chemotherapy for women with HER2 positive breast cancer.[28] Dual anti-HER2 therapy remains untested in HER2 positive endometrial cancer and given the emerging breast cancer experiences, we explored HER2 expression in USC, and used in vitro and in vivo models to test single and dual anti-HER2 therapy in USC cell lines and patient derived xenografts with and without HER2 gene amplification.

116

Dual HER2 therapy precludes uterine serous carcinoma xenograft growth

Methods Tissue samples Using an institutional review board (IRB) approved protocol, a retrospective cohort of 42 patients with USC, who were surgically treated at our institution between 2000 and 2012, was established. Formalin fixed, paraffin embedded primary USC specimens of all patients were obtained from the pathology department. Immunohistochemistry Paraffin embedded USC tissue sections of 5 µm thickness were subjected to immunohistochemistry (IHC) for HER2 using the HercepTest™ (Dako), following the manufacturer’s recommendations. The intensity and pattern of the HER2 membrane immunostaining were evaluated, and all samples were scored by a pathologist on a 0 - 3+ scale with 0 representing no staining, 1+ representing weak staining in >10% of invasive tumor cells, 2+ representing moderate intensity in >10% of invasive carcinoma cells or intense staining in < 10%, and 3+ staining defined as intense circumferential membranous staining in > 10% of the invasive carcinoma. USC xenograft sections (5 µm) were examined for Ki-67 expression levels by IHC. Antigen retrieval was performed using a 10 mM citrate buffer, and slides were treated with 3% hydrogen peroxide. The blocking reagent and antibody diluent of a M.O.M. kit (Vector Laboratories) were used following the manufacturer’s instructions. Sections were incubated with a primary antibody against Ki-67 (clone MIB-1, Dako), followed by incubation with an anti-mouse secondary antibody (M.O.M. kit, Vector Laboratories). Slides were then treated with Vectastain ABC reagents (Vector Laboratories) and further visualized using 3,3’-diaminobenzidine chromogen (Dako). The percentage of Ki-67 stained nuclei was determined by counting four different fields of each tumor sample. The number of cells counted was 400 cells ± 100 per field. Sections with no primary antibody were used as negative controls. Fluorescence in situ hybridization To determine the HER2 gene copy number of primary USC samples and USC cell line derived xenografts, fluorescence in situ hybridization (FISH) was performed on 5 µm thick tissue sections. A PathVysion HER2 DNA Probe Kit (Abbott Laboratories) was used, consisting of an LSI HER2 probe with SpectrumOrange label and a CEP 17 control probe with a SpectrumGreen

117

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 6

tag directed against the centromere region of chromosome 17. Counterstaining was carried out using Vectashield mounting medium with 4,6-diamidino-2-phenylindole (DAPI; Vector Laboratories). All samples were visualized and scored using the CytoVision® platform (Leica Biosystems). For each specimen, the HER2 to CEP 17 ratio was determined by counting the red (HER2) and green (CEP 17) signals in a minimum of 50 nuclei. Samples with a HER2 to CEP 17 ratio greater than 2.0 were considered amplified. Cell culture Three established human, non-immortalized USC cell lines (ARK1, ARK2 and SPEC2) were generously provided in 2011 by Dr. I. Fidler (MD Anderson Cancer Center, Houston, TX, USA) and Dr. A. Santin (Yale University, New Haven, CT, USA) and have been characterized in previous reports.[30, 31] Each cell line was derived from a patient with USC. We authenticated these cell lines by confirming the HER2 protein and gene status, as well as serous histology via pathologic review. ARK1 and ARK2 cell lines were cultured in RPMI1640 medium (Corning) supplemented with 10% fetal bovine serum (FBS), 1% penicillin and streptomycin (Life Technologies). SPEC2 cells were cultured in MEM medium containing Earle’s salts and L-glutamine, supplemented with 10% FBS, 1 mM sodium pyruvate, 2% MEM Vitamin Solution and 1% MEM Non-Essential Amino Acids (Life Technologies). BT-474 breast cancer cells were cultured in DMEM/F12 medium with L-glutamine, supplemented with 10% FBS. All cell lines were maintained in an atmosphere containing in 5% CO2 at 37 ºC. Drugs Lapatinib was purchased from LC Laboratories. Trastuzumab was obtained from the clinical pharmacy of the institution. USC model genotyping An adapted version of the Applied Biosystems Prism SNaPshot multiplex system was used to genotype 3 mm core samples from the EnCa1 and EnCa2 primary tumors, as well as extracted genomic DNA from the three non-immortalized human cell lines ARK1, ARK2 and SPEC2 as previously described.[29] This clinical mutational profiling platform screens for 130 wellcharacterized mutations that are distributed across 15 cancer genes including AKT1, APC, BRAF, CTNNB1, EGFR, ERBB2, IDH1, KIT, KRAS, MAP2K1, NOTCH1, NRAS, PIK3CA, PTEN, and TP53.[29]

118

Dual HER2 therapy precludes uterine serous carcinoma xenograft growth

In vitro treatment of USC cell lines ARK1, ARK2 and SPEC2 were seeded on 6-well plates and serum starved using growth medium containing 1% FBS. The following day, cells were treated in duplicate with increasing concentrations of lapatinib or trastuzumab in growth medium with 1% FBS. Treated cells were incubated for 2 days (lapatinib) or 5 days (trastuzumab), then collected and counted. With trastuzumab dose response experiments, the HER2 over-expressing breast cancer cell line BT474 was co-treated to serve as positive control for drug response. After having determined the IC50 dose of lapatinib for each cell line, cells treated with this dose for 48 hours were used for western blotting analyses of members of the PI3K and MAPK signaling pathways. Generation and propagation of USC xenografts All mouse studies were carried out in compliance with the Institutional Animal Care and Use Committee guidelines. Xenografts derived from ARK2 or SPEC2 cells were established by subcutaneous (s.c.) injection of cultured cells into 6 - 8 week old female NOD/SCID mice (Jackson Laboratory), in a 1:1 suspension of PBS and Matrigel (BD Biosciences). Patient derived USC xenografts were established as previously described.[32] Briefly, primary human USC specimens were obtained under an IRB approved tissue collection protocol. They were enzymatically processed, followed by depletion of endothelial and hematopoietic cells. The remaining purified USC cells were suspended in PBS with Matrigel (1:1) and injected s.c. into 6 - 8 week old female NOD/SCID mice. Xenograft formation was monitored regularly, and mice were euthanized by CO2 inhalation when tumors had reached a diameter of 15 - 20 mm. Tumors were then excised and enzymatically processed, followed by depletion of H-2Kd positive mouse cells. The resulting single tumor cells were resuspended in PBS/Matrigel (1:1) and re-injected s.c. into female NOD/SCID mice. Serial transplantation of USC xenografts resulted in the generation of cohorts of mice that each harbored a tumor derived from the same primary USC. A total of 217 mice were euthanized in order to conduct the described in vivo experiments. Treatment of mice harboring USC xenografts Mice bearing xenografts derived from ARK2 or SPEC2 cells were randomized into two groups of 5 (ARK2) or 6 (SPEC2) mice with equivalent average tumor volumes. The formula [length in mm x width in mm x height in mm] / 2 derived from caliper measurements was used to calculate tumor volumes as has previously been described.[32] One arm was treated with lapatinib (150 mg/kg) and the control arm received its vehicle (0.5% hydroxypropylmethylcellulose, 0.1% Tween 80), administered by oral gavage once daily for 6 days per week.

119

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 6

Because the efficacy of trastuzumab in an immunocompromised NOD/SCID animal model could be impaired, we administered single agent trastuzumab (10 mg/kg) or vehicle to a cohort of 7 NOD/SCID mice bearing BT-474 cell line derived xenografts with matched tumor growth. Subsequently, cohorts of mice harboring ARK2 or SPEC2 cell line derived xenografts as well as EnCa1 or EnCa2 patient derived xenografts were randomly divided into four groups of 6 (ARK2, EnCa2) or 7 (SPEC2, EnCa1) mice each. The different treatment regimens were as follows: 1) vehicle control: 0.5% hydroxypropyl-methylcellulose, 0.1% Tween 80 by oral gavage (lapatinib vehicle) and sterile water by intra-peritoneal (i.p.) injection (trastuzumab vehicle); 2) i.p. injection of trastuzumab (10 mg/kg) and oral gavage of the lapatinib vehicle; 3) lapatinib (150 mg/kg) by oral gavage and administration of the trastuzumab vehicle by i.p. injection; and 4) lapatinib by oral gavage and trastuzumab by i.p. injection. Trastuzumab and its vehicle were administered twice weekly, while lapatinib and its vehicle were administered once daily for 6 days per week as has been previously described. Tumors were measured every 3 - 4 days with calipers and mice were weighed weekly. Treatment periods spanned 14 - 21 days. At the end of each treatment study, mice were euthanized and xenografts were harvested. Portions of each xenograft were snap frozen as well as formaldehyde fixed and paraffin embedded for further analyses. To study the effects of acute treatment on downstream targets of HER2, mice bearing ARK2, SPEC2, EnCa1 or EnCa2 xenografts received a single dose of either vehicle, trastuzumab, lapatinib or trastuzumab and lapatinib. Mice were euthanized and xenografts were harvested 6 hours after treatment. Tumor portions were snap frozen and other pieces formaldehyde fixed and paraffin embedded. Western blotting Frozen xenograft samples or pelleted cells were lysed using a buffer of Mammalian Protein Extraction Reagent (Thermo Scientific) supplemented with kinase, protease and phosphatase inhibitors (Sigma-Aldrich). Protein lysates were resolved on 10% Bis-Tris gels (NuPAGE Novex, Life Technologies) and transferred to PVDF membranes (Millipore). After blocking, membranes were incubated overnight with the primary antibody at 4ยบC. Primary antibodies directed against phospho-Akt (p-Akt, Thr308), Akt, phospho-Erk1/2 (p-Erk1/2, Thr202/ Tyr204), Erk1/2, phospho-PRAS40 (p-PRAS40, Thr246), PRAS40, phospho-p70S6K (p-p70S6K, Thr389) and p70S6K (all from Cell Signaling Technology) were used. The dilution for all primary antibodies was 1:1000. The blots were then probed with a horseradish peroxidase conjugated goat anti-rabbit secondary antibody (Santa Cruz Biotechnology) and developed

120

Dual HER2 therapy precludes uterine serous carcinoma xenograft growth

using a chemiluminescent detection reagent (ECL Prime, GE Healthcare Life Sciences). Each blot was stripped with 1 M glycine when the same membrane was used to re-probe with another primary antibody. Finally, all membranes were stripped and re-probed with either a mouse anti-Pan-actin antibody (1:10000, NeoMarkers) or a rabbit anti-GAPDH antibody (1:1000, Cell Signaling Technology) to verify equal protein loading. TUNEL assay Apoptosis was assessed in paraffin embedded xenograft sections of 5 μm thickness, collected at the end of each four-arm treatment experiment. The DeadEnd Fluorometric TUNEL System (Promega) was used, according to the manufacturer’s instructions with minor modifications. A negative control without addition of rTdT enzyme was included. Detection of fragmented DNA was conducted on a fluorescence microscope (Nikon Eclipse). For each sample, the number of DAPI-stained nuclei and the number of TUNEL-positive nuclei were quantified in four randomly selected fields using Fiji software (ImageJ). The TUNEL index was calculated as the number of TUNEL-positive cells × 100 / total number of nuclei. Statistical analysis Fisher exact testing was utilized for comparison of proportions. Survival analysis was done using the Kaplan-Meier method along with a Cox proportional hazards model incorporating age and stage of disease as continuous variables. Two-way ANOVA analysis was used to determine the statistical significance of the effects of lapatinib treatment on the different cell lines in vitro. Statistical significance of the observed differences in xenograft growth and mouse weights between the different treatment arms was assessed with non-parametric Wilcoxon rank sum tests. One-way ANOVA analyses were performed to determine significance of the observed differences in Ki-67 and TUNEL positive cell counts. Stata software version 11.1, (StataCorp, LP) and GraphPad Prism software version 6 (GraphPad Software, Inc.) was used, and a p-value < 0.05 was considered statistically significant.

Results Prevalence of HER2 protein over-expression and HER2 gene amplification in USC HER2 protein expression as well as HER2 gene copy number were analyzed in a cohort of 42 primary USC tissue blocks. Supplemental Table 1 summarizes the clinical characteristics of the corresponding patients. The mean age of the cohort was 68.7 years, and all stages of disease

121

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 6

were represented with an average overall survival rate of 2.4 years from diagnosis. IHC for HER2 revealed 2+ or 3+ protein expression in 55% of the cohort (Figure 1A and 1B). A lower rate of HER2 gene amplification (HER2 to CEP 17 ratio > 2.0) was observed by FISH, with 10 of 42 USC samples (24%) found to be amplified (Figure 1A and 1B). HER2 gene amplification significantly associated with HER2 protein over-expression in our cohort (p < 0.02, Figure 1B). When comparing clinical outcome of HER2 amplified USCs with non-amplified tumors, a worse overall survival rate was observed in patients harboring HER2 amplification when controlling for age and stage (p = 0.015, Figure 1C). Cell line genotyping Multiplex tumor analysis of both EnCa1 and EnCa2 revealed no gain of function mutations, although the testing confirmed the heightened HER2 gene dosage that was observed on FISH analysis. No gain of function mutation was detected in the ARK2 cell line, though a PIK3CA mutation (1624G to A, E542K) was confirmed in ARK1 as has been described [33], and SPEC2 was found to harbor an NRAS mutation (34G to T, G12C) of uncertain clinical significance. HER2 inhibition using lapatinib and trastuzumab in USC cell lines HER2 protein over-expression (3+ staining) and gene amplification were demonstrated in ARK1 and ARK2 derived xenografts by IHC and FISH, while SPEC2 derived tumors were shown to harbor low protein expression and normal HER2 gene status (Supplementary Figure 1). In all three USC cell lines, treatment with trastuzumab showed no effect on cell proliferation (data not shown). However, a dose dependent reduction in cell number was found in ARK1 and ARK2 cells after lapatinib treatment as compared to vehicle controls. ARK2 cells showed the strongest response to lapatinib treatment in vitro, with observed IC50 values of 0.05 ÂľM for ARK2 and 0.5 ÂľM for ARK1 (p < 0.0001, Figure 2A). ARK1 was sensitive at higher doses compared to ARK2 likely as a result of the PIK3CA gene mutation that uncouples the HER2 inhibition. We next studied the effect of lapatinib treatment on signaling molecules downstream of HER2, by assessing protein expression and phosphorylation of members of the PI3K and MAPK pathways. Western blotting analyses showed decreased levels of phosphorylated Akt (Thr308) in ARK1 and ARK2 cells and reduced expression of phosphorylated Erk in ARK2 and SPEC2 cells after treatment with lapatinib, compared with untreated controls (Figure 2B). The levels of total Akt and Erk proteins were not affected by treatment with lapatinib.

122

Figure 1

Dual HER2 therapy precludes uterine serous carcinoma xenograft growth

100x

HER2 protein expression High Total (%) Low HER2 non-amplified HER2 gene status HER2 amplified

Survival probability

0.00 0.25 0.50 0.75 1.00

Total (%)

6 0

4 Years

8 HER2 non-amplified HER2 amplified

Figure 1. HER2 gene amplification was observed in 24% of USC specimens, which was significantly associated with HER2 protein over-expression and worse overall survival. A) Representative images of FISH (upper), 100X, and IHC, 10X, (lower) for HER2: upper left HER2 non-amplified; upper right HER2 amplification; lower left HER2 immunostaining score 1+; lower right HER2 immunostaining score 3+. IHC scale bars: 100 Âľm. B) Overview of FISH and IHC findings. A significant association between HER2 gene amplification and 2+ or 3+ HER2 protein expression was found (p < 0.02). Low protein expression was defined as a score of 0 or 1+, and high HER2 protein expression as a score of 2+ or 3+. C) KaplanMeier curve showing the overall survival differences between patients with tumors harboring HER2 gene amplification and patients with tumors with normal HER2 gene status. In a Cox proportional hazards model incorporating age and stage, HER2 amplification independently correlated with overall survival, with a median of 1.2 years for patients with HER2 amplification as opposed to 2.9 years for those with normal HER2 gene status (p = 0.02).

123

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 6

Figure 2. Lapatinib treatment of USC cell lines decreased cell proliferation as well as expression of phosphorylated downstream signaling proteins. A) ARK1, ARK2 and SPEC2 cells were incubated with increasing concentrations of lapatinib in duplicate for 48 hours, followed by quantification of viable cells. A dose dependent reduction in cell count was observed in HER2 amplified ARK1 and ARK2 cells, with the highest sensitivity to lapatinib observed in ARK2 cells (p < 0.0001). The non-HER2 amplified SPEC2 cells were found to be relatively resistant to lapatinib treatment, in which a dose as high as 2 µM was needed to decrease cell numbers with approximately 50%. Average relative changes in cell numbers as compared to untreated controls are shown. Error bars represent the standard error of the mean. B) Cells of each line were treated with 0.5 µM (ARK1), 0.05 µM (ARK2) or 2 µM (SPEC2) lapatinib or medium only and collected 48 hours after treatment. Cells were used for western blotting analyses of total and phosphorylated Akt and Erk. Lapatinib treatment led to reduced levels of p-Akt and p-Erk in ARK2 cells, while a decrease in p-Akt but not p-Erk was found in lapatinib treated ARK1 cells and a decrease in p-Erk but not p-Akt was seen in lapatinib treated SPEC2 cells. Expression of Pan-actin or GAPDH was used as loading control.

124

Dual HER2 therapy precludes uterine serous carcinoma xenograft growth

HER2 inhibition with lapatinib and trastuzumab in USC xenografts HER2 protein over-expression and HER2 gene amplification were observed in EnCa1 xenografts, while low levels of the HER2 protein and gene were found in EnCa2 xenografts (Supplementary Figure 1). The single agent lapatinib experiments employed two cohorts of mice bearing xenografts derived from either ARK2 or SPEC2. A reduction of tumor growth was observed in ARK2 xenografts (p = 0.02), but not in SPEC2 xenografts, following treatment with lapatinib as compared to vehicle treated tumors (Supplementary Figure 2). To further explore the effects of anti-HER2 therapy, four mouse cohorts harboring tumors derived from ARK2 and SPEC2 as well as EnCa1 and EnCa2 were used to study the antitumor efficacy of trastuzumab alone, lapatinib alone and the combination of trastuzumab and lapatinib (Figure 3). Single agent trastuzumab treatment induced significant regression of BT-474 xenografts (p < 0.03), confirming effective targeting of HER2 using trastuzumab in immunocompromised mice (data not shown). In all four USC xenograft cohorts, no significant inhibition of tumor growth was observed following treatment with trastuzumab alone as compared to vehicle treated controls. However, significantly superior anti-tumor activity was observed with the combination of trastuzumab and lapatinib in ARK2 tumors, compared with lapatinib alone and trastuzumab alone (p < 0.01). Similarly, the strongest reduction of EnCa1 tumor growth was found in the dual therapy arm and while statistically different from vehicle, there was no statistical improvement over single agent lapatinib treatment which also significantly inhibited EnCa1 tumor growth (p < 0.03). In both tumors lacking HER2 gene amplification (EnCa2 and SPEC2), no therapy induced anti-tumor activity. Importantly, mouse weights revealed no statistically significant alterations during the treatment period of all xenograft cohorts (Supplementary Figure 3). Effects of HER2 inhibition in vivo on downstream signaling proteins Activity of the PI3K and MAPK pathways was assessed by studying the phosphorylated and total protein levels of Akt, PRAS40, p70S6K and Erk1/2 in xenografts harvested 6 hours after administration of a single dose of trastuzumab, lapatinib, both agents or vehicles only (Figure 4). Reduced levels of p-Akt, p-PRAS40 and p-p70S6K as well as p-Erk1/2 were observed in ARK2 and EnCa1 xenografts following dual therapy with trastuzumab and lapatinib, as compared to vehicle controls. While lapatinib alone led to decreased protein expression of p-Akt and p-Erk, trastuzumab alone did not affect expression of the analyzed proteins. Unlike ARK2 and EnCa1 tumors, HER2 therapies failed to alter phosphorylated protein levels of the analyzed PI3K and MAPK pathway members in the non-HER2 gene amplified SPEC2 and EnCa2 xenografts.

125

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 6

Figure 3. Anti-HER2 therapies of USC xenografts stratified by HER2 gene amplification. Significant antitumor activity of lapatinib and a synergistic effect of lapatinib with trastuzumab were observed in HER2 amplified USC xenografts (ARK2, EnCa1), while no effect was seen in non-amplified xenografts (SPEC2, EnCa2). Mice bearing xenografts derived from ARK2 or SPEC2 cell lines or EnCa1 or EnCa2 primary USCs were treated with either vehicle, lapatinib alone, trastuzumab alone or the combination of lapatinib and trastuzumab. Tumors were measured twice weekly, and the percent change in tumor volume compared to baseline volume (100%) is shown. Error bars represent the standard error of the mean. While no significant anti-tumor effect of trastuzumab, dual therapy with lapatinib and trastuzumab impeded the growth of HER2 amplified ARK2 xenografts when compared to all other arms (p < 0.01). Dual therapy with lapatinib and trastuzumab delayed tumor growth in the EnCa1 xenografts compared to vehicle controls (p < 0.02), though the latter was not statistically different from single agent trastuzumab or lapatinib. In both non-HER2 amplified models (SPEC2 and EnCa2), lapatinib and trastuzumab did not affect xenograft growth. * p < 0.02, ** p < 0.01.

126

Dual HER2 therapy precludes uterine serous carcinoma xenograft growth

Figure 4. Dual treatment with lapatinib and trastuzumab led to decreased levels of downstream phosphorylated signaling proteins only in HER2 amplified USC xenografts. Mice harboring ARK2, SPEC2, EnCa1 or EnCa2 tumors were treated with a single dose of vehicle (V), trastuzumab (T), lapatinib (L) or both drugs (T+L) and euthanized 6 hours later. Xenografts were collected and utilized to assess protein levels of total and phosphorylated Akt, Erk1/2, PRAS40 and p70S6K. Western blotting analyses revealed reduced levels of p-Akt, p-Erk, p-PRAS40 and p-p70S6K in ARK2 and EnCa1 tumors after combination treatment with trastuzumab and lapatinib, while no effect of treatment was seen in non-HER2 amplified SPEC2 and EnCa2 xenografts. Levels of the analyzed total proteins were not affected by any treatment regimen. GAPDH was used as loading control.

Effects of HER2 inhibition on cell proliferation and apoptosis To analyze the effect of treatment with trastuzumab, lapatinib and dual therapy on proliferation and apoptosis, xenograft samples harvested at the end of each treatment experiment were subjected to Ki-67 IHC as well as TUNEL analysis. Significantly decreased expression of Ki-67 was observed in ARK2 and EnCa1 samples treated with lapatinib alone or the combination of trastuzumab and lapatinib, compared with vehicle treated tumors (Figure 5). Treatment with trastuzumab alone led to a smaller though significant decrease in ARK2 Ki-67 levels, while no significant difference was seen in EnCa1 tumors. Increased TUNEL staining was found in ARK2 and EnCa1 xenografts treated with lapatinib with and without trastuzumab, compared with vehicle controls (p < 0.05, Figure 6). These differences in Ki-67 and TUNEL staining were not seen in SPEC2 and EnCa2 treated samples (Supplementary Figures 4 and 5).

127

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

ARK2

EnCa1

Trastuzumab/ Lapatinib

Lapatinib

Trastuzumab

Vehicle

Negative control Tr

% of Ki-67 positive cells

40 30 20 10 0

V as eh tu icl tu zu e zu m La ma ab pa b /L tin ap ib at in ib

*** *** ** **

**** **** * *** ***

as Veh as tu ic tu zu le zu m Lap ma ab a b /L tin ap ib at in ib

% of Ki-67 positive cells

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 6

Figure 5. Lapatinib with and without trastuzumab significantly decreased proliferation of HER2 amplified ARK2 and EnCa1 xenografts. Tumors harvested at the completion of each in vivo treatment study were used to assess cell proliferation by Ki-67 IHC. The percentage of Ki-67 positive nuclei was significantly lower in ARK2 tumors (A) treated with trastuzumab, lapatinib or both agents, compared with vehicle treatment (C). Lapatinib, alone and in combination with trastuzumab, led to a significantly stronger reduction in Ki-67 stained cells as compared to treatment with trastuzumab alone. In EnCa1 xenografts (B), a significant decrease in the percentage of Ki-67 stained nuclei was found following treatment with lapatinib or the combination of lapatinib and trastuzumab (D). Magnification 20x. Scale bars: 100 Âľm. Error bars represent the standard error of the mean. * p < 0.05, ** p < 0.01, *** p < 0.001 and **** p < 0.0001.

128

Figure 5

Dual HER2 therapy precludes uterine serous carcinoma xenograft growth

ARK2 DAPI

Merge

TUNEL Tunel

EnCa1 DAPI

Merge

Trastuzumab/ Lapatinib

Lapatinib

Trastuzumab

Vehicle

TUNEL

** ** **

% of TUNEL positive cells as Veh tu ic zu le m La ma ab pa b /L tin ap ib at in ib

6 4 2 0

EnCa1

% of TUNEL positive cells as Veh tu ic zu le m La ma ab pa b /L tin ap ib at in ib

** **

ARK2

Figure 6. Increased apoptosis was observed in ARK2 and EnCa1 tumors following treatment with lapatinib or the combination of lapatinib and trastuzumab. Xenografts collected at the end of the in vivo treatment experiments were examined for apoptosis using TUNEL analysis. Representative images of TUNEL stained (green) sections with DAPI counterstain (blue) of the differently treated ARK2 (A) and EnCa1 (B) tumors are shown. The percentage TUNEL positive cells was significantly higher in ARK2 (C) and EnCa1 (D) xenografts treated with lapatinib with or without trastuzumab, compared with vehicle controls. Trastuzumab alone had no effect on tumor cell apoptosis. Scale bars: 50 Âľm. Error bars represent the standard error of the mean. * p < 0.05, ** p < 0.01.

Discussion Figure 6 HER2 gene amplification has been shown to be a prevalent and prognostic signature that in other disease sites has been effectively targeted for significant clinical benefit.[34] Echoing clinical trial experience, the data presented here support that USCs present with innate trastuzumab resistance that may be mitigated by administering concurrent lapatinib, an antiHER2 therapy that targets the intracellular domain of the receptor. While in vitro models

129

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 6

demonstrated a reduction in cell viability regardless of HER2 gene amplification status when treated with lapatinib, only HER2 gene amplified xenografts (ARK2, EnCa1) responded to lapatinib in vivo, with the most robust responses observed with the use of combination lapatinib and trastuzumab. This is the first report to our knowledge that has utilized cell line derived and patient derived USC xenografts to suggest that HER2 gene amplification can be a biomarker associated with response to anti-HER2 therapies in USC. Despite unsuccessful efforts in the clinic to utilize HER2 inhibition in high-grade endometrial cancer, these data support a role for the use of dual anti-HER2 therapy in gene amplified USC as has been propounded for the treatment of trastuzumab-resistant breast carcinoma.[35] This preclinical investigation confirms and extends the findings of numerous investigations that have sought to characterize HER2 expression in USC. Early reports of HER2 protein overexpression and gene amplification demonstrated this to be a prevalent signature associated with aggressive disease and a worse prognosis.[19, 36, 37] The rates reported were in the 1730% range for HER2 gene amplification, not dissimilar from that observed in breast and gastric cancers where trastuzumab was found to offer significant benefit.[38] Santin and colleagues later refined this experience, showing that HER2 expression was over-represented in African American women compared to Caucasian women.[39] This finding might lend insight into the increased mortality observed in this population despite similar medical access and care. Most investigators suggested that HER2 gene amplification could be a potent biomarker for the selection of women most likely to respond to trastuzumab prompting the Gynecologic Oncology Group (GOG) to initiate a trial in recurrent endometrial cancer. Despite accruing over 30 women, all with HER2 over-expressing recurrent endometrial tumors, no responses to trastuzumab were observed.[24] While many authors suggested the trial was flawed as it lacked a high proportion of endometrial cancers known to harbor the highest HER2 expression (African American subjects and serous histology), the complete lack of signal may indicate that HER2 over-expressing endometrial cancer presents with innate trastuzumab resistance. In this investigation, we tested trastuzumab and found that in both the USC cell line and patient derived xenografts studied, trastuzumab failed to induce any alterations in vitro or in vivo. We believe this effect was not due to failure of antibody therapies in our models, as trastuzumab induced significant anti-tumor activity in the HER2 over-expressing BT-474 cells. Interestingly, when lapatinib was utilized, all cell lines regardless of gene amplification status demonstrated a decrease in cell viability with higher doses needed for this response in

130

Dual HER2 therapy precludes uterine serous carcinoma xenograft growth

the non-amplified SPEC2 cells. The most robust response to lapatinib was observed in ARK2, likely because SPEC2 lacks HER2 gene amplification, and ARK1 was found to harbor a PIK3CA gene mutation both of which would act to render the tumor cells less sensitive to anti-HER2 therapies. Unlike the in vitro experiments, however, the in vivo studies demonstrated that lapatinib as single agent and in combination with trastuzumab induced significant tumorstatic effects only in those tumors harboring HER2 gene amplification (ARK2, EnCa1). In the non-amplified SPEC2 and EnCa2 xenografts, a complete lack of response to any administered therapy was seen. These models strongly support the hypothesis that HER2 gene amplification is a biomarker for response to HER2 inhibition in USC as has been shown in breast and gastric carcinomas.[11, 34, 40] The anti-tumor effects following HER2 blockade in ARK2 and EnCa1 xenografts were associated with increased apoptosis and decreased proliferation as has been shown in lung and head and neck carcinomas [41, 42] as well as reduced levels of signaling proteins of the PI3K and MAPK pathways. The most potent acute abrogation of p-Erk, p-Akt, p-PRAS40 and p-p70S6K was seen following dual treatment with lapatinib and trastuzumab, supporting a rationale for the synergistic inhibition of tumor growth observed. Unlike breast carcinoma, where HER2 inhibition has been primarily associated with blockades in the PI3K signaling pathway, these findings in USC suggest downregulation of both MAPK and PI3K signaling with dual therapy.[43] In the two different xenograft examples lacking HER2 gene amplification (SPEC2, EnCa2), no downstream alterations could be discerned. This suggests that without the HER2 signature, both trastuzumab and lapatinib fail to produce meaningful changes in the target pathways. It is unclear why HER2 gene amplified USC is impervious to trastuzumab though this phenomenon has been noted in many other non-breast adenocarcinomas found to harbor HER2 positive tumors.[34] In breast carcinoma, much clinical and preclinical effort has been focused on trastuzumab resistant tumor cells. Pohlman et al. and others have reviewed this topic extensively, generally in the setting of breast cancer where trastuzumab is a mainstay of therapy for HER2 over-expressing tumors.[44, 45] Many factors are likely to contribute to this observed preclinical and clinical resistance in endometrial cancer including a high prevalence of PI3K pathway activation via PIK3CA mutation and PTEN loss of function. One potential mechanism of resistance implicates a truncated variant of HER2, p95HER2 that

131

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 6

lacks the extracellular domain (ECD) where trastuzumab binds, thus decreasing therapeutic efficacy.[46] High expression of this variant has been associated with trastuzumab resistance and lapatinib sensitivity in breast cancer, and prospective trials are underway to validate p95HER2 expression as a biomarker associated with response to specific HER2 therapies.[47, 48] Elevated ECD levels have been observed in USC [49], though the expression of p95HER2 in HER2 over-expressing USC has yet to be defined and would require prospective validation as a biomarker associated with resistance to trastuzumab. Investigators have suggested that trastuzumab resistance may be overcome through the use of dual anti-HER2 therapies that interact with the receptor in different ways, either by prohibiting dimerization or tyrosine kinase function. Scaltriti et al. described how breast cancer cell line therapy with lapatinib led to a potent upregulation of HER2 protein expression which subsequently sensitized previously resistant cells to trastuzumab.[50] In the USC xenografts used in this study, concurrent trastuzumab and lapatinib treatment led to the statistically most robust anti-tumor activity when compared to vehicle only in the HER2 gene amplified tumors. Interestingly, the ARK2 cell line derived xenografts exhibited uniform HER2 gene amplification with a ratio > 15.0 in all nuclei counted, whereas the patient derived EnCa1 xenografts demonstrated more heterogeneity regarding HER2 gene amplification. In the latter, a gene copy ratio of 9.0 was found though not all tumor cells demonstrated increased HER2 gene copy numbers. Intra-tumor heterogeneity of HER2 gene amplification was also observed in the retrospective cohort, and has been noted recently in the literature.[20] In the present study, lower anti-tumor activity of dual HER2 inhibition was seen in the EnCa1 xenografts with lower prevalence of HER2 amplified cells when compared with the ARK2 model in which tumor regression was observed. Extrapolating from these pilot data, merging dual anti-HER2 therapy with conventional cytotoxics or an additional biologic could be a rational method to target the non-amplified tumor cells that commonly co-exist in HER2 amplified tumors. Currently, there are no clinical trials registered in the United States examining dual anti-HER2 therapies in HER2 over-expressing endometrial cancer. Two trials that are utilizing HER2 overexpression as a biomarker are a phase II trial of trastuzumab in concert with paclitaxel and carboplatin for upfront therapy of USC (NCT01367002) and a phase I trial testing lapatinib with ixabepilone for recurrent uterine carcinoma and carcinosarcoma. The preclinical data described in this study underscore the potential for USC to harbor innate trastuzumab

132

Dual HER2 therapy precludes uterine serous carcinoma xenograft growth

resistance and suggest that combination therapy with lapatinib induces significant cell death and in vivo anti-tumor activity. Further investigation of dual HER2 inhibition in HER2 gene amplified USC may be warranted in a clinical trial setting.

133

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 6

References 1.

Siegel R, Naishadham D, Jemal A. Cancer statistics, 2012. CA: a cancer journal for clinicians. 2012;62:10-29.

Keys HM, Roberts JA, Brunetto VL, Zaino RJ, Spirtos NM, Bloss JD, et al. A phase III trial of surgery with or without adjunctive external pelvic radiation therapy in intermediate risk endometrial adenocarcinoma: a Gynecologic Oncology Group study. Gynecol Oncol. 2004;92:744-51.

Creutzberg CL, van Putten WL, Koper PC, Lybeert ML, Jobsen JJ, Warlam-Rodenhuis CC, et al. Surgery and postoperative radiotherapy versus surgery alone for patients with stage-1 endometrial carcinoma: multicentre randomised trial. PORTEC Study Group. Post Operative Radiation Therapy in Endometrial Carcinoma. Lancet. 2000;355:1404-11.

Schwartz PE. The management of serous papillary uterine cancer. Curr Opin Oncol. 2006;18:494-9.

Rose PG. Endometrial carcinoma. N Engl J Med. 1996;335:640-9.

Fleming GF, Brunetto VL, Cella D, Look KY, Reid GC, Munkarah AR, et al. Phase III trial of doxorubicin plus cisplatin with or without paclitaxel plus filgrastim in advanced endometrial carcinoma: a Gynecologic Oncology Group Study. J Clin Oncol. 2004;22:2159-66.

Humber CE, Tierney JF, Symonds RP, Collingwood M, Kirwan J, Williams C, et al. Chemotherapy for advanced, recurrent or metastatic endometrial cancer: a systematic review of Cochrane collaboration. Ann Oncol. 2007;18:409-20.

Yarden Y, Sliwkowski MX. Untangling the ErbB signalling network. Nature reviews Molecular cell biology. 2001;2:127-37.

10.

Citri A, Yarden Y. EGF-ERBB signalling: towards the systems level. Nature reviews Molecular cell biology. 2006;7:505-16.

11.

Hechtman JF, Polydorides AD. HER2/neu gene amplification and protein overexpression in gastric and gastroesophageal junction adenocarcinoma: a review of histopathology, diagnostic testing, and clinical implications. Archives of pathology & laboratory medicine. 2012;136:691-7.

12.

Spector NL, Blackwell KL. Understanding the mechanisms behind trastuzumab therapy for human epidermal growth factor receptor 2-positive breast cancer. J Clin Oncol. 2009;27:5838-47.

13.

Baselga J. Treatment of HER2-overexpressing breast cancer. Ann Oncol. 2010;21 Suppl 7:vii36-vii40.

14.

Blackwell KL, Burstein HJ, Storniolo AM, Rugo HS, Sledge G, Aktan G, et al. Overall survival benefit with lapatinib in combination with trastuzumab for patients with human epidermal growth factor receptor 2-positive metastatic breast cancer: final results from the EGF104900 Study. J Clin Oncol. 2012;30:2585-92.

15.

Swain SM, Kim SB, Cortes J, Ro J, Semiglazov V, Campone M, et al. Pertuzumab, trastuzumab, and docetaxel for HER2-positive metastatic breast cancer (CLEOPATRA study): overall survival results from a randomised, double-blind, placebo-controlled, phase 3 study. The lancet oncology. 2013;14:461-71.

16.

Baselga J, Bradbury I, Eidtmann H, Di Cosimo S, de Azambuja E, Aura C, et al. Lapatinib with trastuzumab for HER2-positive early breast cancer (NeoALTTO): a randomised, open-label, multicentre, phase 3 trial. Lancet. 2012;379:633-40.

17.

Krop IE, LoRusso P, Miller KD, Modi S, Yardley D, Rodriguez G, et al. A phase II study of trastuzumab emtansine in patients with human epidermal growth factor receptor 2-positive metastatic breast cancer who were previously treated with trastuzumab, lapatinib, an anthracycline, a taxane, and capecitabine. J Clin Oncol. 2012;30:3234-41.

18.

134

Dual HER2 therapy precludes uterine serous carcinoma xenograft growth

19.

Slomovitz BM, Broaddus RR, Burke TW, Sneige N, Soliman PT, Wu W, et al. Her-2/neu overexpression and amplification in uterine papillary serous carcinoma. J Clin Oncol. 2004;22:3126-32.

20.

21.

22.

Galsky MD, Von Hoff DD, Neubauer M, Anderson T, Fleming M, Nagarwala Y, et al. Target-specific, histologyindependent, randomized discontinuation study of lapatinib in patients with HER2-amplified solid tumors. Invest New Drugs. 2010.

23.

Leslie KK, Sill MW, Lankes HA, Fischer EG, Godwin AK, Gray H, et al. Lapatinib and potential prognostic value of EGFR mutations in a Gynecologic Oncology Group phase II trial of persistent or recurrent endometrial cancer. Gynecol Oncol. 2012;127:345-50.

24.

Fleming GF, Sill MW, Darcy KM, McMeekin DS, Thigpen JT, Adler LM, et al. Phase II trial of trastuzumab in women with advanced or recurrent, HER2-positive endometrial carcinoma: a Gynecologic Oncology Group study. Gynecol Oncol. 2010;116:15-20.

25.

Higgins MJ, Baselga J. Targeted therapies for breast cancer. The Journal of clinical investigation. 2011;121:3797803.

26.

Pazo Cid RA, Anton A. Advanced HER2-positive gastric cancer: current and future targeted therapies. Critical reviews in oncology/hematology. 2013;85:350-62.

27.

Santin AD. Letter to the Editor referring to the manuscript entitled: â&#x20AC;&#x153;Phase II trial of trastuzumab in women with advanced or recurrent HER-positive endometrial carcinoma: a Gynecologic Oncology Group studyâ&#x20AC;? recently reported by Fleming et al., (Gynecol Oncol., 116;15-20;2010). Gynecol Oncol. 2010;118:95-6; author reply 6-7.

28.

Prat A, Baselga J. Dual human epidermal growth factor receptor 2 (HER2) blockade and hormonal therapy for the treatment of primary HER2-positive breast cancer: one more step toward chemotherapy-free therapy. J Clin Oncol. 2013;31:1703-6.

29.

Dias-Santagata D, Akhavanfard S, David SS, Vernovsky K, Kuhlmann G, Boisvert SL, et al. Rapid targeted mutational analysis of human tumours: a clinical platform to guide personalized cancer medicine. EMBO Mol Med. 2010;2:146-58.

30.

31.

Morgan J, Hoekstra AV, Chapman-Davis E, Hardt JL, Kim JJ, Buttin BM. Synuclein-gamma (SNCG) may be a novel prognostic biomarker in uterine papillary serous carcinoma. Gynecol Oncol. 2009;114:293-8.

32.

Groeneweg JW, Hall TR, Zhang L, Kim M, Byron VF, Tambouret R, et al. Inhibition of gamma-secretase activity impedes uterine serous carcinoma growth in a human xenograft model. Gynecol Oncol. 2014;133:607-15.

33.

English DP, Bellone S, Cocco E, Bortolomai I, Pecorelli S, Lopez S, et al. Oncogenic PIK3CA gene mutations and HER2/neu gene amplifications determine the sensitivity of uterine serous carcinoma cell lines to GDC-0980, a selective inhibitor of Class I PI3 kinase and mTOR kinase (TORC1/2). American journal of obstetrics and gynecology. 2013;209:465 e1-9.

34.

Thibault C, Khodari W, Lequoy M, Gligorov J, Belkacemi Y. HER2 status for prognosis and prediction of treatment efficacy in adenocarcinomas: a review. Critical reviews in oncology/hematology. 2013;88:123-33.

35.

Kumler I, Tuxen MK, Nielsen DL. A systematic review of dual targeting in HER2-positive breast cancer. Cancer treatment reviews. 2014;40:259-70.

36.

Santin AD, Bellone S, Van Stedum S, Bushen W, Palmieri M, Siegel ER, et al. Amplification of c-erbB2 oncogene: a major prognostic indicator in uterine serous papillary carcinoma. Cancer. 2005;104:1391-7.

135

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 6

37.

El-Sahwi KS, Schwartz PE, Santin AD. Development of targeted therapy in uterine serous carcinoma, a biologically aggressive variant of endometrial cancer. Expert Rev Anticancer Ther. 2012;12:41-9.

38.

Buza N, Roque DM, Santin AD. HER2/neu in Endometrial Cancer: A Promising Therapeutic Target With Diagnostic Challenges. Archives of pathology & laboratory medicine. 2014;138:343-50.

39.

Santin AD, Bellone S, Siegel ER, Palmieri M, Thomas M, Cannon MJ, et al. Racial differences in the overexpression of epidermal growth factor type II receptor (HER2/neu): a major prognostic indicator in uterine serous papillary cancer. American journal of obstetrics and gynecology. 2005;192:813-8.

40.

Khasraw M, Bell R. Primary systemic therapy in HER2-amplified breast cancer: a clinical review. Expert review of anticancer therapy. 2012;12:1005-13.

41.

Kondo N, Tsukuda M, Ishiguro Y, Kimura M, Fujita K, Sakakibara A, et al. Antitumor effects of lapatinib (GW572016), a dual inhibitor of EGFR and HER-2, in combination with cisplatin or paclitaxel on head and neck squamous cell carcinoma. Oncol Rep. 2010;23:957-63.

42.

Diaz R, Nguewa PA, Parrondo R, Perez-Stable C, Manrique I, Redrado M, et al. Antitumor and antiangiogenic effect of the dual EGFR and HER-2 tyrosine kinase inhibitor lapatinib in a lung cancer model. BMC Cancer. 2010;10:188.

43.

Garrett JT, Sutton CR, Kuba MG, Cook RS, Arteaga CL. Dual blockade of HER2 in HER2-overexpressing tumor cells does not completely eliminate HER3 function. Clin Cancer Res. 2013;19:610-9.

44.

Pohlmann PR, Mayer IA, Mernaugh R. Resistance to Trastuzumab in Breast Cancer. Clin Cancer Res. 2009;15:7479-91.

45.

Wilken JA, Maihle NJ. Primary trastuzumab resistance: new tricks for an old drug. Ann N Y Acad Sci. 2010;1210:53-65.

46.

Scaltriti M, Rojo F, Ocana A, Anido J, Guzman M, Cortes J, et al. Expression of p95HER2, a truncated form of the HER2 receptor, and response to anti-HER2 therapies in breast cancer. J Natl Cancer Inst. 2007;99:628-38.

47.

Han SW, Cha Y, Paquet A, Huang W, Weidler J, Lie Y, et al. Correlation of HER2, p95HER2 and HER3 expression and treatment outcome of lapatinib plus capecitabine in her2-positive metastatic breast cancer. PloS one. 2012;7:e39943.

48.

Arribas J, Baselga J, Pedersen K, Parra-Palau JL. p95HER2 and breast cancer. Cancer Res. 2011;71:1515-9.

49.

Todeschini P, Cocco E, Bellone S, Varughese J, Lin K, Carrara L, et al. Her2/neu extracellular domain shedding in uterine serous carcinoma: implications for immunotherapy with trastuzumab. Br J Cancer. 2011;105:1176-82.

50.

Scaltriti M, Verma C, Guzman M, Jimenez J, Parra JL, Pedersen K, et al. Lapatinib, a HER2 tyrosine kinase inhibitor, induces stabilization and accumulation of HER2 and potentiates trastuzumab-dependent cell cytotoxicity. Oncogene. 2009;28:803-14.

136

Dual HER2 therapy precludes uterine serous carcinoma xenograft growth

Characteristics

n (%)

Age (mean)

68.7

Stage I II III IV

17 (40) 1 (2) 13 (31) 11 (27)

Overall survival (median, years)

2.4

Adjuvant chemotherapy Yes No Radiation

35 (80) 7 (20)

Yes No

11 (26) 31 (74)

Chemotherapy for recurrence Yes No Supplementary figure 1

17 (43) 25 (60)

Radiation for recurrence Yes No

4 (10) 38 (90)

Supplementary Table 1. Clinical characteristics of the 42 USC patients whose tissue specimens were utilized for HER2 immunohistochemical and FISH analyses.

ARK2

SPEC2

EnCa1

EnCa2

100x

Supplementary Figure 1. HER2 expression levels in USC models. HER2 protein expression (A) and gene amplification (B) status of the USC cell line derived and patient derived xenografts that were utilized in this study, as assessed by IHC and FISH. HER2 protein over-expression as well as HER2 gene amplification were observed in ARK1, ARK2 and EnCa1 xenografts, while low HER2 protein expression and normal HER2 gene status were found in SPEC2 and EnCa2 xenografts.

137

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 6

Supplementary Figure 2. Anti-tumor activity of single agent lapatinib treatment was observed in HER2 amplified ARK2 xenografts (p = 0.02), while no response was seen in non-HER2 amplified SPEC2 xenografts. Mice harboring tumors derived from ARK2 or SPEC2 cell lines were treated with either vehicle or lapatinib. Tumors were measured twice weekly, and the percent change in tumor volume compared to baseline volume (100%) is shown. Error bars represent the standard error of the mean.

Supplementary Figure 3. Mouse weight changes over the course of each four-arm treatment study. In all experiments, lapatinib and trastuzumab treatments did not significantly affect mouse weights. Mice were weighed weekly, and the percent changes in weight compared to baseline weights (100%) are shown. Error bars represent the standard error of the mean.

138

Dual HER2 therapy precludes uterine serous carcinoma xenograft growth

SPEC2

EnCa2

Trastuzumab/ Lapatinib

Lapatinib

Trastuzumab

Vehicle

Negative control

Supplementary Figure 4. Ki-67 staining of non-HER2 gene amplified USC xenografts. Unlike the HER2 amplified models, no changes in proliferation were seen upon treatment with lapatinib and/or trastuzumab in SPEC2 (A) and EnCa2 (B) xenografts. Tumors harvested at the completion of each in vivo treatment study were subjected to Ki-67 immunohistochemical analysis. Scale bars: 100 Âľm.

139

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

DAPI

Merge

TUNEL

EnCa2 DAPI

Merge

Lapatinib

Trastuzumab

Vehicle

TUNEL

SPEC2

Trastuzumab/ Lapatinib

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 6

Supplementary Figure 5. HER2 inhibition in mice harboring non-HER2 amplified SPEC2 (A) or EnCa2 (B) xenografts did not affect tumor cell apoptosis, as shown by TUNEL analysis. Representative images of TUNEL (green) and DAPI (blue) stained sections of the differently treated xenografts are shown. Scale bars: 50 Âľm.

Suplementary Figure 5

140

Dual HER2 therapy precludes uterine serous carcinoma xenograft growth

141

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter

HER2 over-expressing high grade endometrial cancer expresses high levels of p95HER2 variant

Whitfield B. Growdon1,2,3, Jolijn W. Groeneweg1,2, Virginia F. Byron1, Celeste M. DiGloria1, Darrell Borger2,4, Rosemary Tambouret2,5, Rosemary Foster1,2,3, Ahmed Chenna6, Jeff Sperinde6, John Winslow6, Bo R. Rueda1,2,3

Vincent Center for Reproductive Biology, Department of Obstetrics and Gynecology, Massachusetts General Hospital, Boston, MA, United States

Harvard Medical School, Boston, MA, United States

Division of Gynecologic Oncology, Department of Obstetrics and Gynecology, Massachusetts General Hospital, Boston, MA, United States

Department of Medicine, Cancer Center, Massachusetts General Hospital, Boston, MA, United States

Department of Pathology, Massachusetts General Hospital, Boston, MA, United States

Monogram Biosciences, San Francisco, CA, United States

Submitted for publication

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 7

Abstract Objective: A subset of high grade endometrial cancer over-expresses HER2 (ERBB2) yet clinical trials have failed to demonstrate any anti-tumor activity utilizing trastuzumab, an approved platform for HER2 positive breast cancer. A truncated p95HER2 variant lacking the trastuzumab binding site may confer resistance. The objective of this investigation was to characterize the expression of the p95HER2 truncated variant in endometrial cancer. Methods: With institutional approval, 86 high grade endometrial tumors were identified with tumor specimens from surgeries performed between 2000-2010. Clinical data were collected and all specimens underwent tumor genotyping, HER2 immunohistochemistry (IHC, HercepTest), HER2 fluorescent in situ hybridization (FISH), along with total HER2 (H2T) and p95HER2 assessment with VeraTag testing. Regression models were used to compare a cohort of 107 breast cancers selected for equivalent HER2 protein expression. Results: We identified 44 high grade endometrioid and 42 uterine serous carcinomas (USC). IHC showed high HER2 expression (2+ or 3+) in 60% of the tumors. HER2 gene amplification was observed in 16 tumors (12 USC, 4 endometrioid). Both HER2 gene amplification and protein expression correlated with H2T values. High p95HER2 expression above 2.8 RF/mm2 was observed in 53% (n = 54), with significant correlation with H2T levels. When matched to a cohort of 107 breast tumors based on HercepTest HER2 expression, high grade endometrial cancer presented with higher p95 levels (p < 0.001). Conclusion: These data demonstrate that compared to breast cancer, high grade endometrial cancer expresses higher levels of p95HER2 possibly providing rationale for the trastuzumab resistance observed in endometrial cancer.

144

HER2 over-expressing high grade endometrial cancer expresses high levels of p95HER2 variant

Introduction Endometrial cancer is the most common gynecologic malignancy in the United States.[1] While most women are cured, 15-20% of patients will present with aggressive subtypes histologically characterized as high grade endometrioid, uterine serous carcinoma (USC) and carcinosarcoma that present with more advanced stage disease commonly refractory to conventional platinum and taxane based chemotherapy.[2] While these tumors account for a minority of endometrial cancers encountered, this high grade subset accounts for the majority of the 8,000 deaths observed annually. Innovative, targeted therapies are needed to improve outcomes.[3] Amplification of the HER2 gene and over-expression of the HER2 protein have been described in many human malignancies including breast, colon, gastric, esophageal and endometrial and for some of these cancers, anti-HER2 therapies have become a mainstay of treatment.[46] The HER2 gene encodes a 185-kDa transmembrane tyrosine kinase receptor and is located on chromosome 17q21. HER2 is a well-characterized member of the human epidermal growth factor receptor superfamily that consists of three other tyrosine kinase receptors (HER1/ EGFR, HER3 and HER4). Upon ligand binding, these receptors dimerize and induce signal transduction through the mitogen-activated protein kinase (MAPK) and phosphatidylinositol 3-phosphate (PI3K) signaling pathways. This downstream activation leads to induction of genes that can promote oncogenic transformation via cell survival, proliferation, angiogenesis and metastasis.[7] For women with HER2 over-expressing breast tumors, HER2 directed therapy has become a treatment platform with numerous FDA approved therapies including trastuzumab, pertuzumab and lapatinib.[8, 9] While HER2 over-expression was initially associated with the most guarded prognosis in breast cancer, the advent of a targeted antiHER2 therapy has resulted in women with these HER2 positive tumors having one of the most favorable prognoses.[10] Like breast cancer, high grade endometrial cancer, including high grade endometrioid, USC and carcinosarcoma, has been shown to harbor a 10-42% rate of HER2 gene amplification with up to 70% of tumors exhibiting HER2 protein over-expression.[6, 11, 12] Numerous studies have demonstrated HER2 over-expressing endometrial cancer to be associated with decreased overall survival. Additionally, preclinical in vitro data has suggested that cells derived from HER2 gene amplified USC tumors are more responsive to anti-HER2 therapies compared to cells derived from non-amplified tumors.[13] Despite promising preclinical data, the two

145

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 7

published phase II trials of anti-HER2 therapy in recurrent endometrial cancer manifested poor responses.[14, 15] One trial evaluated single agent lapatinib, a dual HER1/HER2 inhibitor, and found a 3% response rate, although these patients were not preselected for HER2 over-expression.[15] Another recent phase II trial preselected patients with HER2 overexpressing recurrent endometrial tumors and administered the HER2 monoclonal antibody trastuzumab. Unexpectedly, treatment revealed no responses.[14] Despite an extensive body of breast and gastric cancer literature suggesting HER2 over-expression to be a biomarker for response to anti-HER2 therapy, these targeted therapies failed to demonstrate any activity in endometrial cancer, even in a preselected population enriched for HER2 over-expression. These trials suggest that single agent therapies directed against HER2, even in the setting of gene amplification and/or protein over-expression, have limited effect, possibly due to innate or drug induced resistance pathways. Resistance to HER2 directed therapy is a common event in oncology, particularly in breast cancer.[16] Investigators have proposed many potential resistance mechanisms including expression of a constitutively active p95HER2 variant that results from either an alternative translational start site or post-translational proteolysis that cleaves the HER2 extracellular domain (ECD) but preserves the intracellular tyrosine kinase domain.[17, 18] Antibodies directed towards HER2, such as trastuzumab, cannot bind in the absence of the ECD. Several retrospective analyses of HER2 positive breast cancer found that increased p95HER2 expression correlated with resistance to trastuzumab therapy and poor survival.[19, 20] Preclinical in vitro and in vivo studies demonstrated that p95HER2 exhibited kinase activity that induced tumor proliferation that was resistant to trastuzumab therapy.[18, 19, 21] As a result of these observations, the p95HER2 variant is being actively investigated as a biomarker for trastuzumab resistance in prospective randomized trials incorporating antiHER2 therapies.[22] Similar to trastuzumab resistant breast cancer, high grade endometrial tumors appear to manifest innate anti-HER2 resistance. Numerous investigations have demonstrated that endometrial tumors harbor a high rate of PI3K pathway activation via PIK3CA gene mutation and PTEN inactivation which would act to uncouple HER2 blockade [23, 24], but the presence of the described truncated p95HER2 variant in high grade endometrial cancer is currently unknown. The purpose of this investigation was to evaluate p95HER2 levels utilizing the novel VeraTag technology [19] in a cohort of high grade endometrial tumors and correlate these findings with total HER2 expression, HER2 gene amplification, tumor genotype and clinical

146

HER2 over-expressing high grade endometrial cancer expresses high levels of p95HER2 variant

outcomes. In addition, we sought to understand if the p95HER2 landscape observed in breast cancer is different from that of high grade endometrial cancer.

Methods Patients and samples Following internal review board approval, we identified a cohort of 86 high grade endometrial cancer samples consecutively diagnosed between 2005 and 2011 with available tissue for analysis. Clinical factors were extracted from patient records. All molecular analyses were carried out on formalin fixed and paraffin embedded (FFPE) diagnostic specimens. Hematoxylin and eosin-stained slides were marked for tumor location by a gynecologic oncology pathologist. A separate set of 107 breast carcinomas was identified and matched to the endometrial samples based on the HercepTest score. These samples were used as a comparison group to understand the differences in continuous HER2 and p95HER2 protein expression generated by the VeraTag assays. Immunohistochemistry Paraffin embedded high grade endometrial cancer and breast cancer tissue sections of 5 Âľm thickness were subjected to immunohistochemistry (IHC) for HER2 using the HercepTest (Dako), following the manufacturerâ&#x20AC;&#x2122;s recommendations. The intensity and pattern of the HER2 membrane immunostaining were evaluated, and all samples were scored by a pathologist on a 0 - 3+ scale with 0 representing no staining, 1+ representing weak staining in >10% of invasive tumor cells, 2+ representing moderate intensity in >10% of invasive carcinoma cells or intense staining in <10%, and 3+ staining defined as intense circumferential membranous staining in >10% of the invasive carcinoma. Fluorescence in situ hybridization To determine the HER2 gene copy number of the high grade endometrial cancer samples, fluorescence in situ hybridization (FISH) was performed on 5 Âľm thick tissue sections. A PathVysion HER2 DNA Probe Kit (Abbott Laboratories) was used, consisting of an LSI HER2 probe with SpectrumOrange label and a CEP 17 control probe with a SpectrumGreen tag directed against the centromere region of chromosome 17. Counterstaining was carried out using Vectashield mounting medium with 4,6-diamidino-2-phenylindole (DAPI; Vector Laboratories). All samples were visualized and scored using the CytoVision platform (Leica

147

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 7

Biosystems). For each specimen, the HER2 to CEP 17 ratio was determined by counting the red (HER2) and green (CEP 17) signals in a minimum of 50 nuclei. Samples with a HER2 to CEP 17 ratio greater than 2.0 were considered amplified. Tumor genotyping An adapted version of the Applied Biosystems Prism SNaPshot multiplex system was used to genotype 3 mm core samples from >80% tumor cells from primary FFPE tumors. Total nucleic acids were extracted from each core biopsy using an automated platform based on the FormaPure System (Beckman Coulter Genomics) on a Beckman Coulter Biomek NXP workstation. This clinical mutational profiling platform screens for 130 well-characterized mutations that are distributed across 15 cancer genes including AKT1, APC, BRAF, CTNNB1, EGFR, ERBB2, IDH1, KIT, KRAS, MAP2K1, NOTCH1, NRAS, PIK3CA, PTEN, and TP53.[25] Quantitative HER2 assay Total HER2 protein expression (H2T) was quantified using the HERmark assay as previously described.[26, 27] H2T was quantified through the release of a fluorescent tag conjugated to a HER2 monoclonal antibody (mAb) via a linker that is sensitive to singlet oxygen. The antibody was paired with a biotinylated second HER2 mAb. An avidin-linked photosensitizer molecule produces singlet oxygen upon illumination with red light. Fluorescence, quantified by capillary electrophoresis, was normalized to invasive tumor area on the FFPE tissue section to give final units of Relative Fluorescence / mm2 tumor (RF/mm2). Total HER2 (H2T) measurements in FFPE breast cancer tissues were compared to prespecified cutoffs for HERmark negative (H2T<10.5 RF/mm2) and HERmark positive (H2T>17.8 RF/mm2) with equivocal defined as 10.5 RF/mm2≤H2T≤17.8 RF/mm2, derived from the <5th percentile of centrally determined HER2-positives and the >95th percentile of centrally determined HER2negatives, respectively, within a reference database of 1,090 breast cancer patient samples. H2T > 10.5 RF/mm2 defined the primary cutoff value for elevated H2T expression in our endometrial samples. Quantitative p95HER2 assay P95HER2 (p95) was quantified using the VeraTag platform with a proprietary mAb specific for the active M611-CTF form of p95 as previously described.[19] Briefly, the bound p95 antibody is detected by an anti-mouse secondary antibody conjugated to a fluorescent tag via a linker that is sensitive to reduction by dithiothreitol (DTT). Following release by DTT, the fluorescent signal was quantified as described above. P95 ≥ 2.8 RF/mm2 was used to define

148

HER2 over-expressing high grade endometrial cancer expresses high levels of p95HER2 variant

high p95 protein expression as this value has been associated with trastuzumab resistance in breast cancer.[19] Statistical analysis Two-sided Fisher’s exact tests and χ2 were utilized to compare proportions for univariate analysis. Correlation was assessed utilizing Pearson correlation and Spearman rank sum testing as appropriate. Continuous variables were compared utilizing t-tests and linear regression models. Kaplan–Meier survival estimates were generated from date of histological diagnosis to time of last follow up or death, across the subgroup diagnosed with invasive disease. Log-rank tests were utilized to determine statistical significance of survival curves. A Cox proportional-hazards model, incorporating significant variables on univariate survival analysis, was utilized to identify independent factors associated with overall survival. An α < 0.05 defined statistical significance. Analysis was performed on STATA version 10.0.

Results Clinical characteristics We identified 42 USC and 44 high grade endometrioid carcinomas. The average age of the cohort was 67 with 50% of cases representing stage III and IV disease (Table 1). Median overall survival was 2.9 years. No significant differences in age, stage or overall survival were observed between the USC and endometrioid cohorts. Increased age at diagnosis, stage and residual disease were significantly associated with a worsened overall survival upon univariate analysis. A Cox proportional hazards model incorporating all these variables confirmed that stage was the only variable that associated with worsened overall survival with a HR 3.43 (p = 0.01, 95% CI 1.25 – 2.24). Tumor genotyping As shown in Figure 1, the most prevalent mutations detected in this cohort were in PIK3CA (16%), TP53 (14%), KRAS (7%) and PTEN (7%). No differences were observed in the mutational profile based on histologic subtype. While mutations in PIK3CA, KRAS and PTEN did not associate with overall survival, mutations in TP53 were associated with a significantly worsened overall survival (p = 0.02).

149

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 7

Age (average) Stage

Progressive disease

Endometrioid (n = 44)

Total (n = 86)

68.7

65.6

67.1

III

Yes

No Overall survival (years)

USC (n=42)

2.2

4.0

2.9

Table 1. Cohort characteristics.

Figure 1. Frequency of mutations in driver genes detected in our high grade endometrial cancer cohort. The SNaPshot速 platform was used to test each high grade endometrial cancer tumor sample. No difference in the mutational profile of USC, high grade endometrioid or HER2 3+ samples was detected with the notable exception of TP53 mutations which were significantly more common in USC (p < 0.03).

HER2 protein and gene expression HercepTest IHC revealed high HER2 expression (2+ or 3+) in 60% of the cohort (n = 61) with the remainder manifesting low (0 or 1+) expression (n = 35). HER2 gene amplification was observed in 19% of the cohort (n = 16), however the USC samples accounted for a significant majority when compared to the endometrioid set of samples (n = 12, 29% vs n = 4, 9%, p = 0.03). Gene amplification was associated with a median overall survival of 1.4 years, and this was not statistically different from the 3.6 years observed in the non-amplified cohort (p = 0.07).

150

HER2 over-expressing high grade endometrial cancer expresses high levels of p95HER2 variant

In the high grade endometrial cancer samples, the HERmark assay characterized HER2 protein expression as a continuous variable showing a significant positive correlation between HercepTest and HERmark scores (rho = 0.42, p < 0.001). Similarly, gene amplification was significantly associated with high HERmark scores (p = 0.002) (Figure 2A). An H2T â&#x2030;Ľ 10.5 RF/mm2 score identified significantly fewer cases (n = 20, 23%) when compared to the 2+ or 3+ HercepTest result (n = 50, 58%). Elevated HER2 protein expression defined as 2+ or 3+ staining showed a statistically similar rate of PIK3CA, KRAS, PTEN and TP53 mutation (p = 0.4). High grade endometrioid tumors and USCs presented with similar HERmark score distributions (p = 0.79, Figure 3A). p95HER2 expression in high grade endometrial cancer The VeraTag platform revealed that p95 expression â&#x2030;Ľ 2.8 RF/mm2 was observed in 53% (n = 46) of the endometrial tumor samples tested (Figure 2B). While p95 and H2T demonstrated a positive association (Spearman rho = 0.34), high p95 expression was not associated with HER2 gene amplification (Figure 2B). High grade endometrioid tumors and USCs presented with similar p95 score distributions (p = 0.50, Figure 3B). No association between p95 expression and survival outcomes was observed.

Figure 2. Box plots and scatter plots demonstrating relationship between HER2 gene amplification, total HER2 and p95HER2 protein expression. The double red lines delineate the HERmark negative, equivocal and positive zones which align with centrally determined HER2 status in breast cancer as described in the methods section. A. HER2 gene amplification was associated with a significantly higher H2T score (* p < 0.002). B. HER2 gene amplification was not associated with p95HER2 values. The H2T and p95HER2 values are shown, with the red triangles representing the HER2 gene amplified samples. The red line at p95HER2 = 2.8 RF/mm2 is the cutoff value associated with trastuzumab resistance in breast cancer.

151

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 7

Figure 3. Box plots depicting the H2T and p95HER2 scores of the high grade endometrioid endometrial cancer, USC and breast cancer samples. A. The HERmark H2T scores are not statistically different among the different tumor types, as they were matched by HercepTest score. B. In this setting of equivalent H2T scores, both the USC and high grade endometrioid endometrial cancer samples harbor significantly increased levels of p95HER2 expression as compared to breast cancer samples (* p < 0.001).

Differential expression of p95HER2 and H2T in endometrial and breast carcinoma HERmark testing of 107 breast carcinoma samples, matched to the endometrial cohort based on HercepTest scores, revealed that H2T levels were not statistically different from the 86 endometrial carcinoma samples even when stratified by histology (Figure 4). Despite similar levels of HER2 expression as measured by HercepTest and H2T levels, the endometrial cancer samples presented with significantly elevated p95 levels when compared to those of the breast cancer cohort (p < 0.001). The scatter plots of p95 vs. H2T expression shown in Figure 4 confirm that at every level of baseline H2T expression the endometrial cohort manifests a higher p95 expression, with the most statistically robust differences seen in the USC subset. To confirm a cellular localization pattern of p95HER2 similar to breast carcinoma [21], p95HER2 IHC was performed on high grade endometrial cancer tumor samples. P95HER2 staining intensities varying from a score 0 to a score 3+ were observed, with intense circumferential membranous staining observed in the 3+ samples (Figure 5). These findings are consistent with the staining pattern seen in breast carcinoma cells.[19]

152

HER2 over-expressing high grade endometrial cancer expresses high levels of p95HER2 variant

Figure 4. Scatter plots depicting H2T and p95HER2 expression levels observed in the USC, high grade endometrioid and total high grade endometrial cancer cohorts in comparison to a cohort of breast cancer matched for HER2 protein expression using the HercepTest. At every level of H2T expression, the endometrial cancer samples harbor an elevated p95HER2 expression level as compared to the breast cancer samples. Red circles represent endometrial cancer samples with the best fit line in red, black circles represent breast cancer samples with the best fit line in black. A. USC samples only, B. high grade endometrioid samples only, and C. entire endometrial cancer cohort.

7 Figure 5. Immunohistochemical analysis of p95HER2 expression. Representative sections of 0, 1+, 2+ and 3+ immunostaining scores are shown, demonstrating the specificity of the membranous staining. A value of > 2.8 RF/mm2 as measured with the p95HER2 VeraTag assay corresponds with a 2+ or 3+ intensity of immunostaining and was used as the cutoff for elevated p95HER2 expression, as this is the level that was associated with trastuzumab resistance based on a retrospective cohort of breast tumors. [19]

153

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 7

Discussion These data demonstrate that across all levels of total HER2 expression, endometrial tumors present with an innate elevation of p95HER2 expression when compared to breast tumors. While exploratory, these data may provide rationale for the differential responses observed when women with breast cancer and endometrial cancer were treated with trastuzumab. Our genotyping results in endometrial cancer highlight that gain of function mutations in PIK3CA and KRAS that could act to uncouple trastuzumab action, do not appear to affect a disproportionate subset of the HER2 positive cohort. These data suggest that in high grade endometrial cancer, both expression of the p95HER2 variant and gain of function mutations in PIK3CA are likely to be of importance in modifying response to trastuzumab. Trastuzumab has been a mainstay of treatment for HER2 positive (over-expressing and/or gene amplified) breast cancer.[10] Numerous investigators have identified HER2 over-expression or gene amplification in other cancers, such as gastric, esophageal, ovarian and endometrial. [4, 5] Despite the hope that any HER2 positive tumor will respond to trastuzumab therapy, clinical trial results in other disease sites have failed to produce clinical benefit as robust as that demonstrated in breast cancer.[28-30] Endometrial cancer is emblematic of this challenge. The clinical trial testing trastuzumab therapy in HER2 positive recurrent endometrial cancer demonstrated no responses suggesting that HER2 over-expression is not the sole predictor of response.[14] Investigators attempted to rationalize the negative results by suggesting the test population lacked large numbers of USC and HER2 gene amplified tumors.[31] Given the complete lack of response, one must consider that endometrial cancer may present with innate trastuzumab resistance and that additional therapies, such as conventional cytotoxics, are required in concert with HER2 blockade to induce anti-tumor effects. In breast cancer, trastuzumab resistance has been linked to loss of PTEN function and gain of function mutations in downstream signaling proteins, such as PIK3CA.[16] Endometrial cancer harbors the most frequent alterations in the PI3K pathway of any solid tumor, making this an attractive candidate to explain the observed clinical resistance.[24] Echoing more comprehensive genomic analyses [24], our investigation confirmed that HER2 expression did not correlate with the presence of gain of function mutations suggesting that additional factors contribute to the observed resistance. One promising factor characterized in breast tumors that led to a plausible explanation of treatment failure was expression of the p95HER2 truncated variant that lacks the ECD required for trastuzumab binding. Expression of

154

HER2 over-expressing high grade endometrial cancer expresses high levels of p95HER2 variant

p95HER2 in breast cancer diminished sensitivity to trastuzumab in vitro, and was associated with reduced clinical response to trastuzumab with a subsequently decreased survival. [19, 21] Using the VeraTag technology, this investigation demonstrates that a significant proportion of high grade endometrial cancers exhibits elevated p95HER2 as defined by a threshold associated with trastuzumab resistance in breast cancer.[20] While this is the first report to characterize p95HER2 expression in high grade endometrial cancer, these data are consistent with another investigation that demonstrated that HER2 over-expressing USC cell lines shed HER2 ECD in vitro, leading the authors to conclude that response to therapy could be associated with the degree of cleaved ECD.[32] When the p95HER2 and full length HER2 expression profiles in high grade endometrial cancer were compared to breast tumors matched by the most widely used HER2 IHC test in the clinical setting (HercepTest), the p95HER2 levels in endometrial tumors were significantly higher. These data suggest the HER2 landscape is fundamentally different in endometrial cancer compared to breast cancer and possibly predisposes these tumors to innate trastuzumab resistance. Although HER2 over-expressing endometrial tumors, particularly USC, have been associated with aggressive disease and worsened survival in numerous investigations [6, 33], expression of the p95HER2 variant did not correlate with important clinical factors such as stage and survival. In the breast literature, p95HER2 status has been shown to have prognostic value because those patients who had been treated with trastuzumab had been shown to be more refractory to this therapy.[19] In our cohort of endometrioid and USC tumors, no patients received trastuzumab or any anti-HER2 therapies making conclusions about the p95HER2 contribution to survival or response to therapy difficult to assess. Given that p95HER2 expression is likely to be a factor conferring resistance to anti-HER2 therapies that target the ECD of HER2, one could hypothesize that the presence or absence of elevated p95HER2 expression would not be related to clinical response or overall survival unless trastuzumab therapy was a major part of the therapeutic strategy. This investigation confirms a significant body of literature that has found HER2 overexpression and gene amplification to be prevalent amongst high grade endometrial cancer. [34] While the rate of HER2 gene amplification was significantly higher in USC compared to the endometrioid tumors, both histologies exhibited similar HERmark total HER2 expression. Numerous studies have supported that HER2 is a promising target for the treatment of endometrial tumors not curable with surgery or radiation [35], the majority of which are high grade endometrial cancers. The general conclusion of these studies is that tumors harboring

155

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 7

HER2 protein over-expression with concurrent gene amplification will likely be the most responsive to anti-HER2 therapies.[36] Unfortunately, the available clinical data do not yet provide support for this rational position. The addition of this p95HER2 data offers new insight into the HER2 landscape of these high grade endometrial tumors and provides rationale for a therapeutic strategy that utilizes dual anti-HER2 therapy with two agents so that both the ECD and intracellular domain (ICD) can be targeted.[37] This concept has gained traction in the breast cancer literature, with some investigators hypothesizing dual anti-HER2 therapies could replace chemotherapy for a significant subset of patients.[38, 39] While this concept is currently untested in endometrioid endometrial cancer, preclinical models utilizing USC nonimmortalized cell lines and patient derived xenografts supported an approach of combining trastuzumab with lapatinib.[40] This molecular investigation of HER2 expression shows that a significant subset of high grade endometrial cancers presents with elevated expression of the p95HER2 variant when compared to breast carcinomas matched for equivalent HER2 protein expression. As expression of p95HER2 has been associated with trastuzumab resistance, this alteration may contribute to the trastuzumab resistance observed in preclinical studies as well as in the clinical trial setting [20]. Several breast carcinoma trials are actively validating p95HER2 levels as a biomarker associated with resistance to anti-HER2 therapies. Early reports have described that the addition of conventional cytotoxic chemotherapy can act to stabilize full length HER2 and re-sensitize tumors to trastuzumab.[20, 22] These findings validate the ongoing randomized phase II trial in endometrial cancer of conventional carboplatin and paclitaxel therapy with or without trastuzumab (NCT01367002). Given the elevated p95HER2 levels in high grade endometrial cancer compared to breast cancer, p95HER2 expression may be of equal or greater importance as a biomarker as investigators design and conduct future trials in high grade endometrial cancer that test anti-HER2 therapies.

156

HER2 over-expressing high grade endometrial cancer expresses high levels of p95HER2 variant

References 1.

Siegel R, Naishadham D, Jemal A. Cancer statistics, 2013. CA Cancer J Clin. 2013;63:11-30.

Amant F, Moerman P, Neven P, Timmerman D, Van Limbergen E, Vergote I. Endometrial cancer. Lancet. 2005;366:491-505.

Chan DS, Twine CP, Lewis WG. Systematic review and meta-analysis of the influence of HER2 expression and amplification in operable oesophageal cancer. Journal of gastrointestinal surgery : official journal of the Society for Surgery of the Alimentary Tract. 2012;16:1821-9.

Slomovitz BM, Broaddus RR, Burke TW, Sneige N, Soliman PT, Wu W, et al. Her-2/neu overexpression and amplification in uterine papillary serous carcinoma. J Clin Oncol. 2004;22:3126-32.

Yarden Y, Sliwkowski MX. Untangling the ErbB signalling network. Nature reviews Molecular cell biology. 2001;2:127-37.

Baselga J, Cortes J, Kim SB, Im SA, Hegg R, Im YH, et al. Pertuzumab plus trastuzumab plus docetaxel for metastatic breast cancer. N Engl J Med. 2012;366:109-19.

10.

Baselga J. Treatment of HER2-overexpressing breast cancer. Ann Oncol. 2010;21 Suppl 7:vii36-40.

11.

12.

Livasy CA, Reading FC, Moore DT, Boggess JF, Lininger RA. EGFR expression and HER2/neu overexpression/ amplification in endometrial carcinosarcoma. Gynecol Oncol. 2006;100:101-6.

13.

Konecny GE, Venkatesan N, Yang G, Dering J, Ginther C, Finn R, et al. Activity of lapatinib a novel HER2 and EGFR dual kinase inhibitor in human endometrial cancer cells. Br J Cancer. 2008;98:1076-84.

14.

15.

16.

Pohlmann PR, Mayer IA, Mernaugh R. Resistance to Trastuzumab in Breast Cancer. Clin Cancer Res. 2009;15:7479-91.

17.

Christianson TA, Doherty JK, Lin YJ, Ramsey EE, Holmes R, Keenan EJ, et al. NH2-terminally truncated HER-2/ neu protein: relationship with shedding of the extracellular domain and with prognostic factors in breast cancer. Cancer Res. 1998;58:5123-9.

18.

Anido J, Scaltriti M, Bech Serra JJ, Santiago Josefat B, Todo FR, Baselga J, et al. Biosynthesis of tumorigenic HER2 C-terminal fragments by alternative initiation of translation. The EMBO journal. 2006;25:3234-44.

19.

Sperinde J, Jin X, Banerjee J, Penuel E, Saha A, Diedrich G, et al. Quantitation of p95HER2 in paraffin sections by using a p95-specific antibody and correlation with outcome in a cohort of trastuzumab-treated breast cancer patients. Clin Cancer Res. 2010;16:4226-35.

157

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 7

20.

Duchnowska R, Sperinde J, Chenna A, Haddad M, Paquet A, Lie Y, et al. Quantitative measurements of tumoral p95HER2 protein expression in metastatic breast cancer patients treated with trastuzumab: independent validation of the p95HER2 clinical cutoff. Clin Cancer Res. 2014;20:2805-13.

21.

22.

Parra-Palau JL, Morancho B, Peg V, Escorihuela M, Scaltriti M, Vicario R, et al. Effect of p95HER2/611CTF on the Response to Trastuzumab and Chemotherapy. J Natl Cancer Inst. 2014;106.

23.

Dedes KJ, Wetterskog D, Ashworth A, Kaye SB, Reis-Filho JS. Emerging therapeutic targets in endometrial cancer. Nat Rev Clin Oncol. 2011.

24.

Kandoth C, Schultz N, Cherniack AD, Akbani R, Liu Y, Shen H, et al. Integrated genomic characterization of endometrial carcinoma. Nature. 2013;497:67-73.

25.

26.

Huang W, Reinholz M, Weidler J, Yolanda L, Paquet A, Whitcomb J, et al. Comparison of central HER2 testing with quantitative total HER2 expression and HER2 homodimer measurements using a novel proximity-based assay. American journal of clinical pathology. 2010;134:303-11.

27.

Shi Y, Huang W, Tan Y, Jin X, Dua R, Penuel E, et al. A novel proximity assay for the detection of proteins and protein complexes: quantitation of HER1 and HER2 total protein expression and homodimerization in formalin-fixed, paraffin-embedded cell lines and breast cancer tissue. Diagn Mol Pathol. 2009;18:11-21.

28.

Bookman MA, Darcy KM, Clarke-Pearson D, Boothby RA, Horowitz IR. Evaluation of monoclonal humanized anti-HER2 antibody, trastuzumab, in patients with recurrent or refractory ovarian or primary peritoneal carcinoma with overexpression of HER2: a phase II trial of the Gynecologic Oncology Group. J Clin Oncol. 2003;21:283-90.

29.

30.

Bang YJ, Van Cutsem E, Feyereislova A, Chung HC, Shen L, Sawaki A, et al. Trastuzumab in combination with chemotherapy versus chemotherapy alone for treatment of HER2-positive advanced gastric or gastro-oesophageal junction cancer (ToGA): a phase 3, open-label, randomised controlled trial. Lancet. 2010;376:687-97.

31.

32.

33.

34.

English DP, Roque DM, Santin AD. HER2 Expression Beyond Breast Cancer: Therapeutic Implications for Gynecologic Malignancies. Mol Diagn Ther. 2013;17:85-99.

35.

Roque DM, Santin AD. Updates in therapy for uterine serous carcinoma. Current opinion in obstetrics & gynecology. 2013;25:29-37.

36.

Buza N, Roque DM, Santin AD. HER2/neu in Endometrial Cancer: A Promising Therapeutic Target With Diagnostic Challenges. Archives of pathology & laboratory medicine. 2014;138:343-50.

37.

Kumler I, Tuxen MK, Nielsen DL. A systematic review of dual targeting in HER2-positive breast cancer. Cancer treatment reviews. 2014;40:259-70.

38.

158

HER2 over-expressing high grade endometrial cancer expresses high levels of p95HER2 variant

39.

40.

Groeneweg JW, Hernandez SF, Byron VF, DiGloria CM, Lopez H, Scialabba V, et al. Dual HER2 Targeting Impedes Growth of HER2 Gene Amplified Uterine Serous Carcinoma Xenografts. Clin Cancer Res. 2014.

159

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter General discussion

Chapter 8

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39 162

General discussion

The research presented in this thesis describes two distinct molecular signaling alterations in serous gynecologic cancers and the effects of targeted inhibition of these molecules on tumor growth as well as on downstream signaling or cancer stem cell function. Activity and inhibition of the Notch pathway were evaluated in ovarian serous carcinoma and uterine serous carcinoma (USC), while HER2 expression and therapeutic targeting of this receptor were investigated in USC. Inhibition of Notch signaling in serous ovarian cancer High grade serous tumors represent the most prevalent subtype of ovarian cancer. An increasing body of evidence links various molecular aberrations to the progression and recurrence of serous ovarian carcinomas, highlighting a potential role for therapeutic targeting of these molecular alterations.[1-3] The aim of the research presented in chapter 3 was to study the effectiveness of Notch inhibition as monotherapy and in combination with standard chemotherapy in serous ovarian, patient derived xenografts. In line with recent studies focusing on Notch pathway activity in ovarian cancer [4-7], the data reported in chapter 3 show various levels of total and cleaved Notch1 and Notch3 proteins in the analyzed serous ovarian carcinoma specimens. Preclinical studies have demonstrated effective inhibition of ovarian cancer cell proliferation following inhibition of the Notch pathway using a Îł-secretase inhibitor (GSI).[6, 8, 9] We confirmed the in vitro efficacy of the GSI MRK-003 in OVCAR3 and SKOV3 ovarian cancer cell lines. This GSI was then tested in vivo using mice bearing xenografts derived from primary human serous ovarian carcinoma samples, stratified based on their clinical response to platinum-based chemotherapy. Single agent MRK-003 therapy significantly inhibited xenograft growth of two out of three platinum sensitive as well as one out of three platinum resistant ovarian tumors. Response to MRK-003 treatment did not correlate with Notch1 and Notch3 protein levels in the analyzed xenografts. While our research was the first to study the effectiveness of Notch inhibition in primary human ovarian cancer xenografts, these results are in line with a previous study showing reduced tumor growth in vivo following GSI treatment of xenografts derived from ovarian cancer cell lines. [10] Furthermore, our findings are consistent with various studies reporting the preclinical efficacy of MRK-003 in other malignancies including lung, breast and pancreatic cancer.[1113] Several investigators have shown a correlation between elevated Notch3 levels and resistance to platinum-based chemotherapy. In vitro, increased sensitivity to carboplatin has been found following Notch3 knockdown.[14] Moreover, synergistic anti-tumor activity by GSI-mediated

163

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 8

inhibition of Notch signaling in concert with cisplatin was shown in vivo in ovarian cancer cell line derived xenografts.[10] Likewise, we observed significantly augmented inhibition of tumor growth following dual treatment with GSI and paclitaxel in xenografts derived from platinum resistant ovarian cancer, compared with single agent therapy with paclitaxel or GSI. In platinum sensitive xenografts, the addition of GSI to standard paclitaxel/carboplatin (P/C) treatment did not augment its effect on tumor growth. These findings suggest that the Notch pathway could be an attractive therapeutic target particularly in ovarian cancers resistant to platinum-based chemotherapy. Besides tumor progression, metastasis and resistance to chemotherapy, Notch signaling appears to be implicated in ovarian cancer stem cell (CSC) activity.[15-17] We have sought to determine the effects of treatment with the GSI MRK-003 or chemotherapy (P/C) on the expression of CSC markers and genes expressed in cells with stem-like properties (chapter 4). Previous studies of ovarian and other malignancies have described decreased CSC content in tumors following Notch inhibition, and increased expression of CSC markers after chemotherapy.[10, 12, 13, 18-20] With these findings as well as the synergistic response to dual GSI/paclitaxel treatment in our platinum resistant ovarian cancer models in mind, we hypothesized that GSI would help to reduce ovarian CSC activity. However, our results indicate that Îł-secretase inhibition induces no change in CSC marker expression or mRNA levels of genes involved in stem cell function. These findings are in contrast with a recent study demonstrating decreased ovarian CSC fractions following treatment with a GSI in ovarian cancer cell lines.[10] This discrepancy may be explained in part by the different CSC markers and ovarian cancer samples used: McAuliffe et al. worked with murine and human ovarian cancer cell lines and considered side population fractions to represent the CSC populations in flow cytometry assays, while we utilized patient derived ovarian cancer xenografts and evaluated expression of the CSC markers CD133 and CD44. However, McAuliffe and colleagues also studied CD44 mRNA expression after GSI therapy and, unlike our investigation, observed decreased CD44 levels post treatment. Compared with established ovarian cancer cell lines, primary human ovarian cancer xenografts constitute more heterogeneous tumors, potentially harboring various CSC populations. In addition, other signaling pathways may contribute to CSC activity, as separate entities or via crosstalk with the Notch pathway, and thus be responsible for the lack of CSC response to GSI therapy. An alternative explanation for this surprising outcome may be the capability of Notch inhibitors to target both the CSC and the bulk tumor cell populations, which would lead to unchanged CSC marker percentages in tumors after GSI treatment. Nonetheless, studies in other solid tumors that utilized patient

164

General discussion

derived xenografts did demonstrate decreased CSC activity following Notch inhibition.[13, 21] In line with previous studies, we observed increased expression of a subset of CSC markers and stemness genes following P/C treatment. These data confirm that although chemotherapeutic agents effectively target the bulk of ovarian tumors, they fail to eradicate the CSC populations. Although no effect of GSI treatment on CSC markers and stem cell genes was found, the synergistic anti-tumor efficacy of GSI and P/C in platinum resistant ovarian cancer xenografts reported in chapter 3 suggests that GSI does target a population of cells that would otherwise survive chemotherapy. In preclinical studies, the use of primary human xenografts is commonly preferred over cell lines considering their similarity with clinical tumors. Further research, using clinical samples or patient derived xenograft models such as the one described in this thesis, is therefore needed to assess the effect of Notch inhibition on CSC activity in ovarian cancer. Inhibition of Notch signaling in uterine serous carcinoma Serous carcinomas of the ovary and uterine corpus share characteristics like histologic features, their aggressive nature with a commonly observed advanced stage disease at diagnosis, and treatment strategies that entail cytoreductive surgery and platinumbased chemotherapy. While our group and others have previously shown distinct genetic backgrounds of serous ovarian cancer and USC [22-24], the Cancer Genome Atlas Network has recently demonstrated many overlapping genomic alterations in USC and high grade serous ovarian carcinomas.[25] The observed somatic copy number alteration (SCNA) patterns as well as the minimal DNA methylation changes and high frequency of TP53 mutations in USC were similar to high grade serous ovarian cancers. However, this study also showed that somatic mutations are more frequent in USC and the previously described prevalence of Notch pathway alterations in serous ovarian carcinomas was not reported in serous uterine tumors.[2, 25] We have aimed to extend our research on the Notch pathway and have been the first to study Notch expression and its potential as a molecular target in serous carcinomas of the uterus. As described in chapter 5, high nuclear Notch1 protein expression was observed in 58% of analyzed USC specimens, as compared to 12% in endometrioid endometrial carcinomas. Unlike the previously reported association of Notch1 protein and mRNA levels with advanced stage disease in serous ovarian cancer [5], no correlation between nuclear Notch1 protein levels and disease stage or overall survival was found in our USC cohort. Considerably worse survival rates were seen in this cohort compared with the average outcomes reported in ovarian cancer, which may have diluted a possible association. Similar to our findings in serous ovarian cancer (chapter 3), treatment of USC cell lines with

165

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 8

MRK-003 decreased cell proliferation as well as protein expression of cleaved Notch1 and Hes1 mRNA levels. In addition, MRK-003 treatment of mice bearing xenografts derived from cell lines or primary human USC samples revealed moderate though significant anti-tumor activity in two out of three cell line derived xenograft cohorts and one out of two patient derived xenograft cohorts. When this GSI was given in combination with chemotherapy (P/C), synergistic inhibition of tumor growth was seen in one of two patient derived xenograft models. These findings suggest that Notch inhibition may selectively target cell populations that are resistant to standard chemotherapy in a subset of USCs. While we have failed to demonstrate an effect of Notch inhibition on ovarian CSCs (chapter 4), other studies have shown decreased expression of CSC markers following GSI therapy in a variety of cancers. [12, 13, 18, 21, 26] Whether or not Notch inhibition targets a stem cell like population in USC remains to be determined. Clinical studies of Notch inhibitors in serous gynecologic cancers Our preclinical data suggest that GSIs may have value as a therapeutic target in a subset of ovarian and uterine serous cancers. Early phase clinical trials assessing the efficacy of GSIs have been conducted in various solid tumors, using GSI as single agent or in combination with standard chemotherapy, and more than 40 clinical trials are currently ongoing or have recently been completed (clinicaltrials.gov, 09/10/2014). Clinical effects of GSIs have been observed in several malignancies, with combination therapies showing the strongest anti-tumor activity. [13, 27-34] In contrast with the preclinical evidence of Notch inhibition in serous ovarian cancer, clinical trials so far have shown little to no response in ovarian cancer patients. Three studies have tested a GSI as single agent or in combination with gemcitabine against a variety of tumors including ovarian cancer.[27, 29, 33] Prolonged stable disease was observed in three out of nine patients with ovarian cancer treated with the GSI RO4929097 [29], whereas another phase I study found no clinical effectiveness of treatment with RO4929097 in combination with gemcitabine in two out of two ovarian cancer patients.[33] A third phase I trial reported no clinical benefit of the GSI MK-0752 in three out of three patients with ovarian tumors.[27] These findings should be interpreted with caution considering the very small sample size, and larger clinical studies of GSIs in ovarian cancer are warranted. The only current phase II trial focusing exclusively on ovarian cancer evaluates the efficacy of the GSI RO4929097 as single agent in recurrent and/or metastatic disease. While the clinical efficacy of Notch inhibitors in USC remains to be determined, one ongoing phase I trial explores the anti-tumor activity of RO4929097 in combination with the mTOR inhibitor temsirolimus in patients with advanced stage renal cell and endometrial cancers including USC. Additional

166

General discussion

clinical trials that assess the effectiveness of a GSI as single agent or in combination with standard chemotherapy in USC may be warranted. Identification of a biomarker that could select patients most likely to benefit from GSI therapy is of pivotal importance. While multiple studies have sought to determine a molecular alteration that could predict which tumors would respond to Notch inhibition, the results thus far have been conflicting. Our work indicates that protein expression of Notch1 in USC and Notch1 and Notch3 in ovarian cancer does not correlate with sensitivity to GSI treatment. Further functional studies of the Notch pathway and its downstream effectors will be required to identify an appropriate marker for therapeutic response. HER2 inhibition in uterine serous carcinoma The second part of this thesis has focused on the HER2 receptor in USC. Several studies have shown HER2 protein over-expression and gene amplification in this disease, with reported amplification rates of 13-42%.[35-38] These numbers are similar to HER2 amplification rates commonly observed in breast and gastric cancers, where anti-HER2 therapy has become an important treatment strategy.[39, 40] In USC, HER2 over-expression was found to be associated with a worse prognosis.[35] The aim of our research was to evaluate the effect of therapeutic targeting of HER2 in USC, both in vitro using established USC cell lines as well as in vivo using xenografts derived from cell lines and primary human USC tissue samples. As described in chapter 6, our investigation confirms the presence of HER2 protein over-expression (55%) and gene amplification (24%) in a substantial proportion of USCs. In addition, we observed a significantly decreased overall survival in patients harboring tumors with HER2 gene amplification. In contrast with a previous study showing in vitro effectiveness of HER2 inhibition with the monoclonal antibody trastuzumab in HER2 amplified USC cell lines [41], no change in proliferation of either two HER2 amplified USC cell lines or one nonamplified USC cell line was observed following treatment with trastuzumab. Moreover, our in vivo experiments showed no effect of single agent trastuzumab on the growth of HER2 amplified and non-amplified USC xenografts. These results are in line with a recent clinical trial that found no clinical benefit of trastuzumab in HER2 over-expressing recurrent endometrial cancers, of which one third were serous carcinomas.[42] Interestingly, we have demonstrated that administration of the tyrosine kinase inhibitor (TKI) lapatinib reduced cell proliferation of USC cell lines and in vivo treatment with lapatinib resulted in significant inhibition of HER2 amplified USC xenograft growth. The combination of lapatinib and trastuzumab showed the strongest anti-tumor activity in the HER2 gene amplified xenograft models. These results

167

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 8

and the lack of response to any anti-HER2 therapy seen in the non-amplified USC xenografts strongly support the hypothesis that HER2 gene amplification is a useful biomarker for response to HER2 inhibition in USC. The mechanisms of the observed resistance to trastuzumab in our HER2 amplified USC models remain unclear. Although anti-HER2 therapy with trastuzumab is an effective treatment strategy for HER2 positive breast cancers, a subset of breast tumors becomes impervious to trastuzumab.[43] This development of trastuzumab resistance has recently been a focus of preclinical and clinical research in breast carcinomas. Resistance mechanisms that have been described include over-expression of other members of the HER receptor family, aberrations in downstream pathways causing activation of signaling regardless of HER2 blockade, and expression of a truncated variant of HER2 (p95HER2) lacking the trastuzumab binding site but maintaining tyrosine kinase activity.[43, 44] PIK3CA mutations and PTEN loss of function, both activating the PI3K pathway downstream of HER2, represent frequent alterations in endometrial cancer and may therefore be involved in trastuzumab resistance in this disease. However, tumor genotyping showed that none of the USC cell lines and primary tissues utilized for our in vivo experiments harbored PIK3CA or PTEN mutations. We next evaluated the presence of the p95HER2 form of HER2 in USC and high grade endometrioid endometrial cancer, to explore the potential role of this variant in resistance to trastuzumab. As described in chapter 7, a relatively higher p95HER2 expression level was observed in endometrial tumors including USC, as compared to breast tumors. The reported difference in p95HER2 content may explain in part the distinct response to trastuzumab that has been seen in breast and uterine serous cancers, and suggests that expression of p95HER2 in USC is a mechanism for trastuzumab resistance. In breast cancer, lapatinib was found to be equally effective in reducing tumor growth in patients with p95HER2 positive and p95HER2 negative HER2 positive breast carcinomas.[45] Although the p95HER2 status of our HER2 positive USC xenografts is unknown, the observed efficacy of lapatinib suggests a similar function of lapatinib in USC. The most robust anti-tumor activity was seen following dual therapy with trastuzumab and lapatinib in our HER2 amplified USC xenograft models. A similar synergistic effect of the combination of trastuzumab and lapatinib has been reported in other solid tumors, including breast and gastric cancers.[46-48] Our group was the first to describe this phenomenon in USC. The synergistic activity of dual anti-HER2 therapy correlated with a stronger reduction of PI3K and MAPK signaling pathway protein levels in the HER2 amplified USC xenografts, compared with trastuzumab alone and lapatinib alone.

168

General discussion

The preclinical data described in chapter 6 underscore the potential efficacy of dual HER2 inhibition in HER2 gene amplified USC, and further investigation of this treatment strategy in a clinical setting is warranted. In addition, treatment regimens combining HER2 inhibition with standard chemotherapy may provide additional anti-tumor activity in USC by targeting the tumor fractions with and without over-expression of HER2. Currently, no clinical trials exist that assess the effectiveness of dual HER2 inhibition in USC. Yet, one phase II trial evaluates the efficacy of trastuzumab with paclitaxel and carboplatin in HER2 positive USC, and a phase I trial is testing lapatinib with ixabepilone in HER2 positive recurrent endometrial carcinoma and carcinosarcoma. Clinical studies focusing on HER2 inhibition in USC only may be most useful as many characteristics of this disease, including its rate of HER2 gene amplification, differ from other endometrial cancers. Notch and HER2 Strategies combining two or more targeting agents may provide additional benefit in ovarian cancer and USC, as multiple signaling aberrations can be involved in tumor growth and crosstalk between different signaling pathways has been reported. One potential combination could be dual HER2 and Notch inhibition, particularly in USC. Previous studies have demonstrated that HER2 gene amplification is a rare event in serous ovarian cancer, and limited effectiveness of HER2 inhibition was shown in this tumor type.[2, 49] In breast cancer, an interaction between Notch1 signaling and HER2 receptor activity has been described. HER2 inhibition was found to increase Notch1 activity, while GSI treatment led to decreased HER2 expression levels.[50, 51] In addition, synergistic anti-tumor effects were observed following treatment with trastuzumab or a TKI in combination with GSI, and Notch inhibition helped to restore trastuzumab sensitivity in resistant cells.[50, 52] The high prevalence of HER2 gene amplification and Notch1 protein expression described in USC suggests that (pre) clinical evaluation of dual targeting of HER2 and Notch may be worthwhile. While the expression of Notch1 and response to GSI appear to be similar in serous ovarian and serous uterine carcinomas, differences in HER2 over-expression and efficacy of HER2 inhibition have been observed. These findings indicate that although several overlapping alterations exist, these two gynecologic malignancies carry distinct genetic changes that may require differential targeting to achieve optimal results. In contrast with the current management, which largely overlaps, different therapeutic strategies including targeted therapy may be needed for serous uterine and serous ovarian cancers.

169

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 8

Summary 1. Single agent efficacy of a GSI was seen in a subset of patient derived serous ovarian cancer xenografts, and synergistic anti-tumor activity of GSI with paclitaxel was observed in all analyzed platinum resistant tumors. 2. High Notch1 protein expression was found in the majority of analyzed uterine serous carcinomas and GSI treatment showed single agent efficacy as well as synergistic inhibition of tumor growth when combined with paclitaxel / carboplatin in a subset of USC xenografts. 3. While HER2 gene amplified USC appears to be resistant to trastuzumab but sensitive to lapatinib, dual anti-HER2 therapy with trastuzumab and lapatinib was proven most effective in reducing USC xenograft growth. The development of targeted therapies is of particular importance in serous gynecologic cancers, as both serous ovarian and serous uterine carcinomas portend a poor prognosis with high recurrence rates following first line chemotherapy. We have described the preclinical effectiveness of therapeutic strategies targeting the Notch pathway or the HER2 receptor in these tumors. Our findings indicate that clinical trials are warranted to further assess the therapeutic efficacy of targeting Notch and/or HER2 in serous gynecologic cancers. While we and others have shown that HER2 gene amplification serves as a biomarker for response to HER2 inhibition, a marker for response to Notch inhibition has yet to be identified and requires further investigation. A growing body of evidence supports individualized treatment strategies that vary based on the molecular profile of each tumor and our research has provided novel rationale for such approaches in serous gynecologic tumors.

170

General discussion

References 1.

Banerjee S, Kaye SB. New strategies in the treatment of ovarian cancer: Current clinical perspectives and future potential. Clin Cancer Res. 2013 Mar 1;19(5):961-8.

Cancer Genome Atlas Research Network. Integrated genomic analyses of ovarian carcinoma. Nature. 2011 Jun 29;474(7353):609-15.

Birrer MJ. Ovarian cancer: Targeting the untargetable. Am Soc Clin Oncol Educ Book. 2014:13-5.

Rose SL, Kunnimalaiyaan M, Drenzek J, Seiler N. Notch 1 signaling is active in ovarian cancer. Gynecol Oncol. 2010 Apr;117(1):130-3.

Wang M, Wang J, Wang L, Wu L, Xin X. Notch1 expression correlates with tumor differentiation status in ovarian carcinoma. Med Oncol. 2010 Dec;27(4):1329-35.

Park JT, Li M, Nakayama K, Mao TL, Davidson B, Zhang Z, et al. Notch3 gene amplification in ovarian cancer. Cancer Res. 2006 Jun 15;66(12):6312-8.

Choi JH, Park JT, Davidson B, Morin PJ, Shih I, Wang TL. Jagged-1 and Notch3 juxtacrine loop regulates ovarian tumor growth and adhesion. Cancer Res. 2008 Jul 15;68(14):5716-23.

10.

11.

12.

13.

14.

15.

16.

Steg AD, Bevis KS, Katre AA, Ziebarth A, Dobbin ZC, Alvarez RD, et al. Stem cell pathways contribute to clinical chemoresistance in ovarian cancer. Clin Cancer Res. 2012 Feb 1;18(3):869-81.

17.

18.

19.

Latifi A, Abubaker K, Castrechini N, Ward AC, Liongue C, Dobill F, et al. Cisplatin treatment of primary and metastatic epithelial ovarian carcinomas generates residual cells with mesenchymal stem cell-like profile. J Cell Biochem. 2011 Oct;112(10):2850-64.

20.

Liu YP, Yang CJ, Huang MS, Yeh CT, Wu AT, Lee YC, et al. Cisplatin selects for multidrug-resistant CD133+ cells in lung adenocarcinoma by activating notch signaling. Cancer Res. 2012 Nov 7.

171

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 8

21.

22.

Santin AD, Zhan F, Bellone S, Palmieri M, Cane S, Gokden M, et al. Discrimination between uterine serous papillary carcinomas and ovarian serous papillary tumours by gene expression profiling. Br J Cancer. 2004 May 4;90(9):1814-2.

23.

Nowee ME, Seeber LM, Horree N, Snijders AM, Van Diest PJ, Verheijen RH, et al. Array comparative genomic hybridization analysis indicates that serous carcinomas of the ovary, fallopian tube and endometrium are distinct entities. Histopathology. 2010 Oct;57(4):634-7.

24.

25.

Cancer Genome Atlas Research Network, Kandoth C, Schultz N, Cherniack AD, Akbani R, Liu Y, et al. Integrated genomic characterization of endometrial carcinoma. Nature. 2013 May 2;497(7447):67-73.

26.

Sullivan JP, Spinola M, Dodge M, Raso MG, Behrens C, Gao B, et al. Aldehyde dehydrogenase activity selects for lung adenocarcinoma stem cells dependent on notch signaling. Cancer Res. 2010 Dec 1;70(23):9937-48.

27.

Krop I, Demuth T, Guthrie T, Wen PY, Mason WP, Chinnaiyan P, et al. Phase I pharmacologic and pharmacodynamic study of the gamma secretase (notch) inhibitor MK-0752 in adult patients with advanced solid tumors. J Clin Oncol. 2012 Jul 1;30(19):2307-13.

28.

Fouladi M, Stewart CF, Olson J, Wagner LM, Onar-Thomas A, Kocak M, et al. Phase I trial of MK-0752 in children with refractory CNS malignancies: A pediatric brain tumor consortium study. J Clin Oncol. 2011 Sep 10;29(26):3529-34.

29.

Tolcher AW, Messersmith WA, Mikulski SM, Papadopoulos KP, Kwak EL, Gibbon DG, et al. Phase I study of RO4929097, a gamma secretase inhibitor of notch signaling, in patients with refractory metastatic or locally advanced solid tumors. J Clin Oncol. 2012 Jul 1;30(19):2348-53.

30.

Strosberg JR, Yeatman T, Weber J, Coppola D, Schell MJ, Han G, et al. A phase II study of RO4929097 in metastatic colorectal cancer. Eur J Cancer. 2012 May;48(7):997-1003.

31.

De Jesus-Acosta A, Laheru D, Maitra A, Arcaroli J, Rudek MA, Dasari A, et al. A phase II study of the gamma secretase inhibitor RO4929097 in patients with previously treated metastatic pancreatic adenocarcinoma. Invest New Drugs. 2014 Aug;32(4):739-45.

32.

Sahebjam S, Bedard PL, Castonguay V, Chen Z, Reedijk M, Liu G, et al. A phase I study of the combination of ro4929097 and cediranib in patients with advanced solid tumours (PJC-004/NCI 8503). Br J Cancer. 2013 Aug 20;109(4):943-9.

33.

Richter S, Bedard PL, Chen EX, Clarke BA, Tran B, Hotte SJ, et al. A phase I study of the oral gamma secretase inhibitor R04929097 in combination with gemcitabine in patients with advanced solid tumors (PHL-078/CTEP 8575). Invest New Drugs. 2014 Apr;32(2):243-9.

34.

Diaz-Padilla I, Hirte H, Oza AM, Clarke BA, Cohen B, Reedjik M, et al. A phase ib combination study of RO4929097, a gamma-secretase inhibitor, and temsirolimus in patients with advanced solid tumors. Invest New Drugs. 2013 Oct;31(5):1182-91.

35.

Slomovitz BM, Broaddus RR, Burke TW, Sneige N, Soliman PT, Wu W, et al. Her-2/neu overexpression and amplification in uterine papillary serous carcinoma. J Clin Oncol. 2004 Aug 1;22(15):3126-32.

36.

37.

38.

Mentrikoski MJ, Stoler MH. HER2 immunohistochemistry significantly overestimates HER2 amplification in uterine papillary serous carcinomas. Am J Surg Pathol. 2014 Jun;38(6):844-51.

39.

Baselga J. Treatment of HER2-overexpressing breast cancer. Ann Oncol. 2010 Oct;21 Suppl 7:vii36-40.

172

General discussion

40.

41.

Santin AD, Bellone S, Gokden M, Palmieri M, Dunn D, Agha J, et al. Overexpression of HER-2/neu in uterine serous papillary cancer. Clin Cancer Res. 2002 May;8(5):1271-9.

42.

43.

Pohlmann PR, Mayer IA, Mernaugh R. Resistance to trastuzumab in breast cancer. Clin Cancer Res. 2009 Dec 15;15(24):7479-7491; ( ) :.

44.

45.

Scaltriti M, Chandarlapaty S, Prudkin L, Aura C, Jimenez J, Angelini PD, et al. Clinical benefit of lapatinib-based therapy in patients with human epidermal growth factor receptor 2-positive breast tumors coexpressing the truncated p95HER2 receptor. Clin Cancer Res. 2010 May 1;16(9):2688-95.

46.

Wainberg ZA, Anghel A, Desai AJ, Ayala R, Luo T, Safran B, et al. Lapatinib, a dual EGFR and HER2 kinase inhibitor, selectively inhibits HER2-amplified human gastric cancer cells and is synergistic with trastuzumab in vitro and in vivo. Clin Cancer Res. 2010 Mar 1;16(5):1509-1.

47.

Baselga J, Bradbury I, Eidtmann H, Di Cosimo S, de Azambuja E, Aura C, et al. Lapatinib with trastuzumab for HER2-positive early breast cancer (NeoALTTO): A randomised, open-label, multicentre, phase 3 trial. Lancet. 2012 Feb 18;379(9816):633-40.

48.

Blackwell KL, Burstein HJ, Storniolo AM, Rugo HS, Sledge G, Aktan G, et al. Overall survival benefit with lapatinib in combination with trastuzumab for patients with human epidermal growth factor receptor 2-positive metastatic breast cancer: Final results from the EGF104900 study. J Clin Oncol. 2012 Jul 20;30(21):2585-92.

49.

Bookman MA, Darcy KM, Clarke-Pearson D, Boothby RA, Horowitz IR. Evaluation of monoclonal humanized anti-HER2 antibody, trastuzumab, in patients with recurrent or refractory ovarian or primary peritoneal carcinoma with overexpression of HER2: A phase II trial of the gynecologic oncology group. J Clin Oncol. 2003 Jan 15;21(2):283-90.

50.

Osipo C, Patel P, Rizzo P, Clementz AG, Hao L, Golde TE, et al. ErbB-2 inhibition activates notch-1 and sensitizes breast cancer cells to a gamma-secretase inhibitor. Oncogene. 2008 Aug 28;27(37):5019-32.

51.

Magnifico A, Albano L, Campaner S, Delia D, Castiglioni F, Gasparini P, et al. Tumor-initiating cells of HER2positive carcinoma cell lines express the highest oncoprotein levels and are sensitive to trastuzumab. Clin Cancer Res. 2009 Mar 15;15(6):2010-21.

52.

Pandya K, Meeke K, Clementz AG, Rogowski A, Roberts J, Miele L, et al. Targeting both notch and ErbB-2 signalling pathways is required for prevention of ErbB-2-positive breast tumour recurrence. Br J Cancer. 2011 Sep 6;105(6):796-80.

173

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter Summary Nederlandse samenvatting

Chapter 9

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39 176

Summary

Summary In this thesis we describe a series of studies assessing the effectiveness of targeted therapies that inhibit Notch signaling or the HER2 receptor in serous gynecologic cancers. In chapter 1, a general introduction to the topics discussed in this thesis is provided. Serous carcinomas of the ovary and uterine corpus are high grade tumors with several shared clinical features including an aggressive behavior, treatment strategies that involve cytoreductive surgery and platinum-based chemotherapy, and a poor prognosis despite these therapeutic modalities. The unfavorable outcomes observed in both malignancies highlight the need for the development of novel therapies. The accumulating evidence showing various molecular alterations in these tumors suggests that therapeutic targeting of these molecules may hold promise in the management of serous ovarian cancer and uterine serous carcinoma (USC). Notch signaling aberrations have been identified in a significant subset of ovarian cancers, while gene amplification of HER2 (ERBB2) is a prevalent signature in USCs. Part I: The Notch signaling pathway as therapeutic target in serous gynecologic cancers Chapter 2 provides an overview of the available literature regarding the role of the Notch signaling pathway and the efficacy of Notch inhibition in serous ovarian cancer. As described in chapter 3, we have confirmed previous data by showing expression of Notch1 and Notch3 in ovarian cancer. Inhibition of the Notch pathway with the gamma-secretase inhibitor (GSI) MRK-003 reduced cell proliferation of ovarian cancer cell lines in vitro. We subsequently utilized patient derived serous ovarian cancer xenografts to study the efficacy of this GSI in vivo and demonstrated single agent anti-tumor activity in half of the analyzed tumors. In addition, a synergistic effect of treatment with GSI in combination with paclitaxel on xenograft growth was found in all analyzed tumors known to be clinically platinum resistant. These findings support previous data showing involvement of Notch signaling in chemoresistance. Few studies have described Notch pathway activity in ovarian cancer stem cells (CSCs) and others have shown reduced levels of CSC markers in ovarian cancer cell lines following in vitro and in vivo GSI therapy. In order to assess the effects of GSI treatment and standard cytotoxic therapy on ovarian CSCs, in chapter 4 we have examined expression levels of the CSC markers CD44 and CD133 and stem cell related genes Nanog, Oct4 and Sox2 in patient derived xenografts after treatment with GSI or paclitaxel and carboplatin (P/C). Our study failed to show an effect of GSI treatment on the levels of the analyzed CSC markers and stemness genes. Compared with vehicle treated tumors, higher levels of CSC marker expressing cells and increased mRNA expression of both CSC markers and two out of three stemness genes

177

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 9

were observed following P/C therapy. These results indicate that while GSI does not alter the relative CSC content in ovarian tumors, P/C therapy leads to enrichment of the CSC fraction in ovarian cancer, presumably by targeting only the non-CSC population. Chapter 5 comprises the first study to date of Notch signaling and the therapeutic targeting of this pathway in USC. Expression of Notch1 was shown in the majority of analyzed USC specimens and in vitro treatment with GSI decreased proliferation of USC cell lines. Furthermore, GSI monotherapy in vivo reduced tumor growth in two thirds of the studied USC cell line derived xenograft cohorts and in half of the analyzed patient derived USC xenograft models. Moreover, GSI treatment augmented the anti-tumor activity of P/C in half of the primary human USC xenograft cohorts. Our data suggest that the Notch signaling cascade is a promising therapeutic target in a subset of USC. Part II: The HER2 receptor as therapeutic target in uterine serous carcinoma In chapter 6 we have assessed the efficacy of HER2 inhibition in USC, using the monoclonal anti-HER2 antibody trastuzumab and the tyrosine kinase inhibitor lapatinib. In our cohort of USC specimens, a 24% rate of HER2 gene amplification and a 55% HER2 over-expression rate were found. None of the analyzed cell lines or primary human USCs responded to in vitro or in vivo trastuzumab therapy. In contrast, lapatinib as single agent reduced proliferation of all USC cell lines in vitro and in vivo inhibited tumor growth only in the HER2 amplified xenografts. The most robust anti-tumor activity was observed in HER2 amplified xenografts when lapatinib was combined with trastuzumab. No in vivo efficacy of anti-HER2 therapy was found in non-HER2 amplified xenografts, suggesting HER2 gene amplification to be a biomarker for response to HER2 inhibition in USC. Our results support the use of dual antiHER2 therapy in HER2 gene amplified USC. The described trastuzumab resistance in our in vitro and in vivo USC models has led to the investigation of p95HER2 expression in USC and high grade endometrioid endometrial cancer. Expression of this truncated variant of the HER2 receptor has been associated with trastuzumab resistance in breast cancer. As shown in chapter 7, we observed a lower degree of total HER2 expression with a proportionally higher p95HER2 expression level in USC and high grade endometrioid tumors, as compared to the co-analyzed breast carcinomas. The differential p95HER2 expression levels between breast cancer and USC provides rationale for the trastuzumab resistance observed in USC.

178

Summary

Finally, chapter 8 consists of the general discussion of the results of the preclinical research presented in this thesis and their clinical implications. The reported preclinical effectiveness of inhibition of Notch and HER2 in ovarian and uterine serous carcinomas suggests that these targeted therapies are promising strategies in serous gynecologic tumors, warranting further investigation in a clinical setting. With accumulating evidence highlighting the importance of personalized cancer treatment, our research supports such efforts in serous gynecologic cancers.

179

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 9

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39 180

Nederlandse samenvatting

Nederlandse samenvatting In dit proefschrift worden de resultaten beschreven van verschillende onderzoeksprojecten naar de effectiviteit van behandelingen gericht tegen de Notch signaalroute en de HER2 receptor in sereuze gynaecologische maligniteiten. Hoofdstuk 1 bevat een algemene introductie waarin de onderwerpen van dit proefschrift besproken worden. Sereuze carcinomen uitgaande van de eierstok (het ovarium) of de baarmoeder (de uterus) zijn hooggradige tumoren met overeenkomstige eigenschappen, zoals agressieve groei, behandeling door middel van cytoreductieve chirurgie gecombineerd met platinum-bevattende chemotherapie en een infauste prognose ondanks deze behandelingsopties. De hoge mortaliteit onder patiĂŤnten met sereus uteruscarcinoom (USC) of sereus ovariumcarcinoom benadrukt het belang van de ontwikkeling van nieuwe therapeutische mogelijkheden. Recente studies hebben verschillende moleculaire veranderingen aangetoond in deze tumoren, welke een aanknopingspunt voor toekomstige behandelingen zouden kunnen vormen. Afwijkingen in de Notch signaalroute zijn beschreven in het ovariumcarcinoom, terwijl amplificatie van het HER2 gen frequent gezien wordt in USC. Deel I: De Notch signaalroute als therapeutisch target in sereuze gynaecologische tumoren Hoofdstuk 2 geeft een overzicht van de tot nu toe verschenen literatuur over de rol van Notch en het effect van Notch remming in het sereuze ovariumcarcinoom. In hoofdstuk 3 beschrijven we de resultaten van ons onderzoek naar de Notch signaalroute en de remming hiervan in deze meest voorkomende vorm van eierstokkanker. Onze studie bevestigt de bevindingen van eerdere studies door de expressie van Notch1 en Notch3, twee verschillende vormen van de Notch receptor, aan te tonen in ovariumtumoren. Wanneer de Notch signaalroute geblokkeerd werd met een gamma-secretaseremmer (GSI), MRK-003, werd een reductie van celgroei gezien in ovariumcarcinoom cellijnen. De in vivo effectiviteit van deze GSI werd vervolgens getest door gebruik te maken van een humaan xenograft model, waarbij tumorweefsel verkregen van geopereerde patiĂŤnten met ovariumcarcinoom werd gebruikt voor het ontwikkelen van tumor xenografts in muizen. Monotherapie met GSI leidde in vivo tot verminderde groei van xenografts bij de helft van de onderzochte tumoren. Voorts werden muizen met ovariumcarcinoom xenografts behandeld met GSI in combinatie met chemotherapie. In alle onderzochte ovariumtumoren die in de kliniek resistent waren bevonden tegen platinum-bevattende chemotherapie, werd een synergistisch anti-tumor effect van de behandeling met GSI in combinatie met paclitaxel gevonden. Deze bevindingen ondersteunen eerdere studies die aantoonden dat de Notch signaalroute een rol speelt in

181

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 9

resistentie tegen chemotherapie en onderstrepen het belang van klinisch onderzoek naar de effectiviteit van Notch remming in het sereuze ovariumcarcinoom. Eerder onderzoek heeft activiteit van de Notch signaalroute aangetoond in kankerstamcellen (cancer stem cells; CSCs) van ovariumtumoren. We hebben daarom in hoofdstuk 4 de effecten van GSI behandeling en standaard chemotherapie (paclitaxel en carboplatin) op ovariumkankerstamcellen onderzocht door de percentages tumorcellen met expressie van de CSC markers CD133 en CD44, alsmede de mRNA levels van deze markers en drie stamcelgenen (Nanog, Oct4 en Sox2), te analyseren in xenografts na behandeling met GSI of chemotherapie. Notch remming leidde in geen van de bestudeerde tumoren tot verandering van de CD133 positieve of CD44 positieve celpopulatie, noch werd een effect van GSI op de mRNA expressie van CD133, CD44, Nanog, Oct4 en Sox2 gevonden. Een toename van de tumorfracties met expressie van CD133 of CD44 en een stijging van de mRNA levels van deze CSC markers en Nanog en Sox2 werden gezien in xenografts na behandeling met paclitaxel en carboplatin, in vergelijking met controle xenografts. Deze resultaten suggereren dat Notch blokkade de relatieve hoeveelheid CSCs in het ovariumcarcinoom niet be誰nvloedt, terwijl chemotherapie alleen de niet-CSC tumorpopulatie bestrijdt hetgeen tot relatieve verrijking van de CSC fractie in ovariumtumoren leidt. Hoofdstuk 5 omvat de eerste studie tot op heden die de rol van Notch en remming van deze signaalroute in USC bestudeert. Expressie van het Notch1 eiwit werd gezien in de meerderheid van de geanalyseerde humane sereuze uterustumoren en in vitro behandeling met GSI verminderde de celproliferatie van USC cellijnen. De behandeling van muizen met GSI remde de groei van xenografts van twee van de drie USC cellijnen evenals de groei van xenografts van een van de twee humane USC tumoren. Bovendien versterkte de combinatie van GSI en paclitaxel en carboplatin het gevonden anti-tumor effect, vergeleken met alleen chemotherapie (paclitaxel en carboplatin) of alleen GSI behandeling, in xenografts van een van de twee humane USC tumoren. Deze bevindingen suggereren dat de Notch signaalroute een potentieel therapeutisch aangrijppunt is voor de behandeling van USC. Verder onderzoek naar Notch remming in USC is derhalve ge誰ndiceerd. Deel II: De HER2 receptor als therapeutisch target in het sereuze uteruscarcinoom In hoofdstuk 6 hebben we de effectiviteit van HER2 remming in USC onderzocht, door gebruik te maken van het monoklonale anti-HER2 antilichaam trastuzumab en de tyrosinekinaseremmer lapatinib. In een cohort van humane USC specimens werd amplificatie

182

Nederlandse samenvatting

van het HER2 gen gevonden in 24% van de tumoren en overexpressie van het HER2 eiwit in 55% van de tumoren. Geen van de onderzochte USC cellijnen of primaire humane USC tumoren reageerde op in vitro of in vivo behandeling met trastuzumab. Daarentegen leidde behandeling met lapatinib tot verminderde proliferatie van USC cellijnen in vitro en tot in vivo reductie van tumorgroei van enkel de xenografts met HER2 genamplificatie. Het grootste anti-tumor effect werd gevonden in HER2 geamplificeerde xenografts behandeld met zowel lapatinib als trastuzumab, hetgeen het gebruik van combinatietherapie met beide HER2 remmers in HER2 geamplificeerd USC ondersteunt. De afwezigheid van in vivo effectiviteit van HER2 remming in niet-geamplificeerde xenografts suggereert dat HER2 amplificatie een bruikbare biomarker is voor de respons op anti-HER2 therapie in USC. De hierboven beschreven resistentie tegen trastuzumab die gezien werd in onze in vitro en in vivo USC modellen heeft geleid tot onderzoek naar p95HER2 expressie in USC en het hooggradig endometrioide endometriumcarcinoom (kanker uitgaande van het baarmoederslijmvlies), zoals beschreven in hoofdstuk 7. Expressie van deze verkorte variant van de HER2 receptor is geassocieerd met trastuzumab resistentie in borstkanker. In onze studie werd een lagere expressie van totaal HER2 en een relatief hoger p95HER2 level gevonden in USC en hooggradig endometrioide endometriumtumoren, vergeleken met borsttumoren die gelijktijdig geanalyseerd werden. Dit verschil in p95HER2 expressie tussen borstkanker en USC zou een verklaring kunnen zijn voor de geobserveerde resistentie tegen trastuzumab in USC. Tot slot bestaat hoofdstuk 8 uit de algemene discussie van de resultaten van het preklinische onderzoek beschreven in dit proefschrift, evenals de klinische implicaties van onze bevindingen. De effectiviteit van remming van Notch en HER2 in de beschreven modellen suggereert dat deze ‘targeted’ therapieën veelbelovend zijn voor de behandeling van sereuze gynaecologische tumoren. Verder onderzoek naar deze anti-tumor effecten in de vorm van klinische trials is derhalve geïndiceerd. Een groeiend aantal studies heeft het belang van een geïndividualiseerde behandeling van kanker aangetoond en ons onderzoek ondersteunt een dergelijke aanpak in eierstokkanker en baarmoederkanker.

183

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter List of publications Acknowledgements (dankwoord) Curriculum Vitae

Chapter 10

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39 186

List of publications

List of publications Groeneweg JW, Foster R, Growdon WB, Verheijen RHM, Rueda BR. Notch signaling in serous ovarian cancer. J Ovarian Res 2014;7:95. [Epub ahead of print] Groeneweg JW, Hernandez SF, Byron VF, DiGloria CM, Lopez H, Scialabba V, Kim M, Zhang L, Borger DR, Tambouret R, Foster R, Rueda BR, Growdon WB. Dual HER2 targeting impedes growth of HER2 gene amplified uterine serous carcinoma xenografts. Clin Cancer Res 2014;20:6517-6528. Groeneweg JW, Hall TR, Zhang L, Kim M, Byron VF, Tambouret R, Sathyanarayanan S, Foster R, Rueda BR, Growdon WB. Inhibition of gamma-secretase activity impedes uterine serous carcinoma growth in a human xenograft model. Gynecol Oncol 2014;133:607-615. Groeneweg JW, DiGloria CM, Yuan J, Richardson WS, Growdon WB, Sathyanarayanan S, Foster R, Rueda BR. Inhibition of Notch signaling in combination with paclitaxel reduces platinum-resistant ovarian tumor growth. Front Oncol 2014;4:171. Bradford LS, Rauh-Hain A, Clark RM, Groeneweg JW, Zhang L, Borger D, Zukerberg LR, Growdon WB, Foster R, Rueda BR. Assessing the efficacy of targeting the phosphatidylinositol 3-kinase/AKT/mTOR signaling pathway in endometrial cancer. Gynecol Oncol 2014;133:346352. Groeneweg JW, White YA, Kokel D, Peterson RT, Zukerberg LR, Berin I, Rueda BR, Wood AW. Cables1 is required for embryonic neural developmentÂ : molecular, cellular and behavioral evidence from the zebrafish. Mol Reprod Dev 2011;78:22-32.

10 187

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 10

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39 188

Acknowledgements (dankwoord)

Acknowledgements (dankwoord) This is it! Writing this final part makes me look back on the past couple of years and think of the many people that supported, helped, guided and encouraged me throughout the course of constructing this thesis. Prof. dr. R.H.M. Verheijen, beste RenĂŠ, het merendeel van mijn onderzoekstijd ben je op enige afstand mijn promotor geweest. Ondanks deze afstand heb je een zeer grote rol gespeeld bij het tot stand komen van dit proefschrift. Ik ben je erg dankbaar dat je me de mogelijkheid hebt gegeven vanuit Boston in Utrecht te promoveren, en bovenal veel dank voor je steun en je kritische blik. Dr. B.R. Rueda, dear Bo, all of this started when you invited me to join your research group in the VCRB. Thank you very much for the confidence you placed in me despite my little experience in basic science, and for everything I have learned from you. It has been a real privilege to be part of your research group and I am honored to have you here as my copromotor during the defense. Dr. R.P. Zweemer, beste Ronald, tijdens ieder overleg wist jij met goede raad te komen. Daarnaast heb je er het afgelopen jaar in Utrecht mede voor gezorgd dat ik me snel thuis voelde in de onco-onderzoeksgroep. Veel dank voor al je hulp en betrokkenheid. Dr. W.B. Growdon, dear Whit, I am so happy to have had the opportunity to work with you. You have been an outstanding mentor and this thesis would not have come this far without your help and support. Thank you very much for everything and for being here for my defense, it means the world to me. Dr. R. Foster, dear Rosemary, our weekly meetings have helped this MD become a bench researcher. Your door was always open for advice. Thank you so much for your guidance and for the good times having a cocktail at AACR or elsewhere. Prof. dr. S.C. Linn, prof. dr. R.H. Medema, prof. dr. H.W. Nijman, prof. dr. P.J. van Diest en dr. W.P. Kloosterman, veel dank voor het beoordelen van dit proefschrift en voor het deelnemen aan de oppositie tijdens de verdediging. Prof. dr. E.M.J.J. Berns, prof. dr. B.C. Fauser en prof. dr. E.E. Voest, dank voor het zitting nemen in de oppositie tijdens de promotieplechtigheid.

189

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 10

My colleagues in the VCRB, thank you all very much for your help, support and friendship. I knew very little about research when I arrived in the lab and I am so grateful for your assistance during my transition into a science geek. Thanks to you, the days in the lab were fun and productive. Kashmira, many thanks for teaching me tons and for being there for advice or a chat. Celeste, you are the best, thank you so much for everything. Virginia, my HER2 buddy, many thanks for your help. Ling, Minji, Tracilyn, Fatima and Sarah, many thanks for working with me on the projects included in this thesis. Maureen, thank you for all your day-to-day help. Ashley, Patricia and Kevin, thank you for your administrative and financial assistance. The staff and fellows of the Gynecologic Oncology division at Massachusetts General Hospital, thank you for your support and for making my research years a little more clinical. Dr. Schiff, thank you for welcoming me in the department of Obstetrics and Gynecology at MGH. Collega onderzoekers in het UMCU en het WKZ, de onderzoekstijd hier kwam voor mij wat laat en was wat kort, maar ik ben blij dat ik een beetje van het groepsgevoel heb mogen meemaken. Veel dank voor het warme welkom, de Nespresso en jullie tips en trucs voor het promoveren in Utrecht. Beste Tessa, veel dank voor al je hulp bij het regelen van afspraken en vele andere praktische zaken. Zonder jou was er weinig van de organisatie van mijn promotie terecht gekomen. Alle gynaecologen, verloskundigen en arts-assistenten in het Gelre ziekenhuis in Apeldoorn, veel dank voor het mij wegwijs maken in, en nog enthousiaster maken voor, de gynaecologie en verloskunde. Ook veel dank voor jullie steun en interesse tijdens de laatste loodjes van dit proefschrift. Ik kijk uit naar de komende twee jaar als AIOS in het Gelre. Lieve Kristen en Roel, Susanne, Sophie, Rosanne en Steven, Margot, Lisette, Caroline, Marieke en Arthur, Marleen en Richard, papa en mama, Hens en Joanneke, Jasper, Thomas, Kristine, Peter en Irma, Constant en Astrid, veel dank voor jullie trips naar Boston, sommigen zelfs meerdere keren. Het was heel fijn jullie even daar te hebben en een goed excuus om iets minder hard te werken en onze stad te laten zien of eropuit te gaan. Alle Bostonse Dutchies en bijna-Dutchies, bedankt voor de leuke etentjes, borrels, weekenden weg, koffie uurtjes, het delen van onderzoeksfrustraties en nog veel meer. Gwen, dank voor

190

Acknowledgements (dankwoord)

de goede vriendschap, ik ben heel blij dat we elkaar bij de VSB dag al tegenkwamen en daarna zoveel hebben beleefd samen. Ingrid, wat een feestje was het jou als Appleton neighbor en stalker te hebben, ik mis je gezelligheid en lach hier in Utrecht. Frannie, I am so glad to have met you in Boston and to now have you as a friend in Holland. Jan Willem en Arjan, heel leuk niet alleen Appleton maar ook Gilford, de Hill e.d. met jullie gedeeld te hebben. Marlien, fijn jou steeds weer terug te zien komen in Boston en gezellig dat we nu Utrecht en het UMCU als homebase delen. Jan-Willem en Anna, ik mis jullie hier, maar bedankt dat jullie ons een reden geven om regelmatig terug naar Boston te komen. Jesper en Marieke, ik kijk ernaar uit binnenkort in Utrecht nog dichter bij elkaar te wonen dan in Boston. Darinka en Hemanth, I am very happy to have gotten to know you and hope to see you soon in New York or Utrecht. Marasja en Tim en Mark en Wampie, dank voor de gezelligheid en tot gauw in het verre zuiden. Lieve vriendinnen en vrienden van het OC, de Appie, de studie, het reizen of andere plaatsen in mijn leven, wat heb ik het getroffen met jullie. Dank jullie wel voor alle steun, interesse en begrip. Ik was een tijdje wat minder sociaal, binnenkort ga ik dit allemaal goedmaken. Lieve Roos en Steef, wat is het fijn om bij jullie met alles terecht te kunnen en met zijn vieren te borrelen of op pad te gaan. Jullie zijn me heel dierbaar. Lieve Suus, mijn geneeskundig leven begon samen met dat van jou en sindsdien hebben we al zoveel meegemaakt samen. Dank voor deze mooie vriendschap en de prachtige reizen. Dear paranymphs, Kristine and Yvonne, I am very lucky with you two standing next to me during the defense. Lieve Kris, bij IFMSA organiseerden we samen uitwisselingen en waren we allebei penningmeester. Ook op medisch gebied vonden we in de gynaecologie en met internationale promoties dezelfde interesses. Wat kunnen we goed urenlang kletsen over van alles en nog wat, maar ook samen vakantie vieren of sparren over het onderzoek. Bedankt voor je steun en de waardevolle vriendschap, ik kijk uit naar de komende jaren samen als AIOS in Utrecht. Dear Yvonne, I am so happy to have met you in the VCRB. You were a great teacher when I was there as a student, working together with the zebrafish. During the PhD years that followed I could still always turn to you for advice. More importantly though, you became a very close friend. Our chats could be endless, the drinks bottomless, the laughter plentiful and the few tears shed with a shoulder to cry on. You and Colin were our home away from home for Thanksgiving and Christmas, which was so much fun. Dear Colin, you too were there for a bit of research advice, but mostly for good times and to bully me a little. Many thanks to you both for everything, I miss you on this side of the Atlantic.

191

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Chapter 10

Lieve families Groeneweg en van de Haar, veel dank voor alle steun en interesse de afgelopen jaren. Ik koester onze familieband. Lieve Astrid en Margot, dank voor het hele fijne tweede thuis eerst in Velars en nu in Delft. Lieve Hens en Joanneke, ik waardeer jullie betrokkenheid enorm. Veel dank hiervoor en voor het warme nest waarin ik me zo thuis voel. Lieve Jasper en Thomas, bedankt voor de gezellige avonden samen eten en voor de buis, en voor jullie oprechte interesse. Lieve Marleen, lief zussie, wat bof ik met jou die zo dichtbij me staat. Het is fijn om te weten dat onze band er altijd zal zijn, of we nu dichtbij of ver weg zijn. Ik bewonder je en ben je heel dankbaar voor al je steun en vriendschap. Daarnaast ook veel dank voor de prachtige tekening voor dit proefschrift. Lieve Richard, wat fijn jou als zwager te hebben. Leuk om te zien dat we in een verschillend specialisme een vergelijkbaar traject volgen. Veel dank voor je betrokkenheid. Lieve papa en mama, jullie hebben me de weg gewezen en me aangemoedigd en de vrijheid geboden mijn eigen weg te gaan. Mama, heel fijn om te merken dat jouw moederlijke bekommeringen ook op afstand altijd blijven bestaan. Papa, jouw grote interesse voor dit voor jou onbekende en waarschijnlijk saaie onderzoek is heel bijzonder. Heel veel dank voor jullie onvoorwaardelijke steun en liefde. Liefste Bart, mijn allerbeste maatje. Wat hebben we een geweldig mooie tijd in Boston beleefd samen en wat heb ik veel aan je gehad tijdens dit promotietraject. Altijd was je er met een luisterend oor, een kritische blik, relativerende woorden of een vrolijke noot. Oneindig groot was jouw steun en is mijn dank hiervoor. Je maakt me enorm gelukkig en ik kijk uit naar meer vrije tijd samen nu binnenkort beide promoties zijn afgerond.

192

Curriculum Vitae

Curriculum Vitae Jolijn Groeneweg was born on November 15th 1984 in Amsterdam. She attended high school at the Oosterlicht College in Nieuwegein, where she graduated in 2002. She then studied French for one year at the University of Burgundy in Dijon, France. In 2003 she started her medical training at Utrecht University. During her years at medical school, Jolijn became particularly interested in the surgical specialties and oncology. She went to Mexico, France, Malawi and the United States for clinical rotations. While in Boston for a rotation in otolaryngology at the Massachusetts Eye and Ear Infirmary, she applied for a five-month research internship at the Vincent Center for Reproductive Biology, part of the department of Obstetrics and Gynecology at Massachusetts General Hospital. She was accepted and went back to Boston during her final year of medical school, investigating the role of the Cables1 gene in embryonic development of the zebrafish under the supervision of Dr. A.W. Wood. This internship resulted in the opportunity to become a research fellow in the same laboratory. After obtaining her medical degree in 2009 and before returning to Boston, Jolijn worked as a surgical resident at the Gelderse Vallei hospital in Ede for a year. She then worked on the research described in this thesis for three years, under the supervision of Dr. B.R. Rueda, Dr. R. Foster and Dr. W.B. Growdon in the Vincent Center for Reproductive Biology as well as Prof. Dr. R.H.M. Verheijen and Dr. R.P. Zweemer at the University Medical Center Utrecht. Since March 2014 Jolijn has been a resident in obstetrics and gynecology at the Gelre hospital in Apeldoorn, where she will continue to work as a resident in training (AIOS) from January 2015 as part of the residency program at the University Medical Center in Utrecht.

10 193

R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 R21 R22 R23 R24 R25 R26 R27 R28 R29 R30 R31 R32 R33 R34 R35 R36 R37 R38 R39

Molecular targets in serous gynecologic cancers

UITNODIGING Voor het bijwonen van de openbare verdediging van het proefschrift

Jolijn Groeneweg

Molecular targets in serous gynecologic cancers Jolijn Groeneweg

Jolijn Groeneweg Zwaansteeg 16 3511 VG Utrecht groeneweg.jolijn@gmail.com +31 6 14 46 77 63